CRISP1 (NM_001131) Human Untagged Clone

CAT#: SC302975

CRISP1 (untagged)-Human cysteine-rich secretory protein 1 (CRISP1), transcript variant 1


  "NM_001131" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CRISP1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "CRISP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRISP1
Synonyms AEGL1; ARP; CRISP-1; HEL-S-57; HSCRISP1D; HSCRISP1G; HUMARP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001131 edited
TGTGTGGACTTGGGGATGGAAATTAAACACCTCTTGTTTTTGGTTGCTGCTGCTTGCTTA
CTGCCTATGTTGTCCATGAAAAAGAAATCAGCTAGAGACCAATTTAATAAGCTCGTCACC
GACTTGCCAAATGTACAAGAAGAGATCGTTAATATACACAACGCCCTCAGGAGAAGAGTA
GTTCCACCAGCCAGCAACATGCTGAAGATGAGTTGGAGTGAAGAGGCTGCACAAAATGCC
AGAATTTTTTCAAAGTATTGTGATATGACAGAGAGCAACCCCCTTGAGAGGAGACTTCCA
AATACCTTTTGTGGAGAAAATATGCATATGACATCTTATCCTGTATCATGGTCAAGTGTA
ATTGGAGTCTGGTACAGTGAGTCTACAAGTTTCAAACATGGAGAATGGACAACAACGGAT
GATGACATAACTACTGACCACTACACTCAGATTGTTTGGGCCACATCTTACCTGATTGGC
TGTGCCATTGCATCTTGCCGCCAACAAGGATCACCTCGATATCTCTACGTTTGTCACTAT
TGTCATGAGGGAAATGATCCTGAAACAAAGAATGAACCTTATAAGACAGGCGTCCCATGT
GAAGCCTGCCCAAGTAACTGTGAAGACAAACTTTGCACTAACCCCTGCATCTACTATGAT
GAATACTTCGACTGTGACATACAAGTCCATTATCTGGGATGCAACCACTCAACAACTATC
CTATTCTGTAAAGCCACTTGTCTGTGTGACACTGAGATAAAATAGTCTAGA
Restriction Sites Please inquire     
ACCN NM_001131
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001131.2, NP_001122.2
RefSeq Size 1892 bp
RefSeq ORF 750 bp
Locus ID 167
UniProt ID P54107
Cytogenetics 6p12.3
Gene Summary Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longer isoform (1). Variants 1 and 3 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.