DYNLL1 (NM_001037495) Human Untagged Clone
CAT#: SC302900
DYNLL1 (untagged)-Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2
"NM_001037495" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DYNLL1 |
Synonyms | DLC1; DLC8; DNCL1; DNCLC1; hdlc1; LC8; LC8a; PIN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302900 representing NM_001037495.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAG TGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTT GACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACACATGAA ACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTTCAAATCTGGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037495 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037495.1 |
RefSeq Size | 747 bp |
RefSeq ORF | 270 bp |
Locus ID | 8655 |
UniProt ID | P63167 |
Cytogenetics | 12q24.31 |
MW | 10.4 kDa |
Gene Summary | Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a distinct 5' UTR including an alternate, downstream transcription initiation site. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218700 | DYNLL1 (Myc-DDK-tagged)-Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2 |
USD 150.00 |
|
RC218700L3 | Lenti ORF clone of Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2, Myc-DDK-tagged |
USD 450.00 |
|
RC218700L4 | Lenti ORF clone of Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2, mGFP tagged |
USD 450.00 |
|
RG218700 | DYNLL1 (tGFP-tagged) - Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review