LAP2 (TMPO) (NM_001032284) Human Untagged Clone

CAT#: SC302624

TMPO (untagged)-Human thymopoietin (TMPO), transcript variant 3


  "NM_001032284" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit anti-TMPO Polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LAP2
Synonyms CMD1T; LAP2; LEMD4; PRO0868; TP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302624 representing NM_001032284.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGAGTTCCTGGAAGACCCCTCGGTCCTGACAAAAGACAAGTTGAAGAGTGAGTTGGTCGCCAAC
AATGTGACGCTGCCGGCCGGGGAGCAGCGCAAAGACGTGTACGTCCAGCTCTACCTGCAGCACCTCACG
GCTCGCAACCGGCCGCCGCTCCCCGCCGGCACCAACAGCAAGGGGCCCCCGGACTTCTCCAGTGACGAA
GAGCGCGAGCCCACCCCGGTCCTCGGCTCTGGGGCCGCCGCCGCGGGCCGGAGCCGAGCAGCCGTCGGC
AGGAAAGCCACAAAAAAAACTGATAAACCCAGACAAGAAGATAAAGATGATCTAGATGTAACAGAGCTC
ACTAATGAAGATCTTTTGGATCAGCTTGTGAAATACGGAGTGAATCCTGGTCCTATTGTGGGAACAACC
AGGAAGCTATATGAGAAAAAGCTTTTGAAACTGAGGGAACAAGGAACAGAATCAAGATCTTCTACTCCT
CTGCCAACAATTTCTTCTTCAGCAGAAAATACAAGGCAGAATGGAAGTAATGATTCTGACAGATACAGT
GACAATGAAGAAGACTCTAAAATAGAGCTCAAGCTTGAGAAGAGAGAACCACTAAAGGGCAGAGCAAAG
ACTCCAGTAACACTCAAGCAAAGAAGAGTTGAGCACAATCAGGTGGGAGAAAAAACAGAGGAAAGAAGA
GTAGAAAGGGATATTCTTAAGGAAATGTTCCCCTATGAAGCATCTACACCAACAGGAATTAGTGCTAGT
TGCCGCAGACCAATCAAAGGGGCTGCAGGCCGGCCATTAGAACTCAGTGATTTCAGGATGGAGGAGTCT
TTTTCATCTAAATATGTTCCTAAGTATGTTCCCTTGGCAGATGTCAAGTCAGAAAAGACAAAAAAGGGA
CGCTCCATTCCCGTATGGATAAAAATTTTGCTGTTTGTTGTTGTGGCAGTTTTTTTGTTTTTGGTCTAT
CAAGCTATGGAAACCAACCAAGTAAATCCCTTCTCTAATTTTCTTCATGTTGACCCTAGAAAATCCAAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001032284
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001032284.2
RefSeq Size 3859 bp
RefSeq ORF 1038 bp
Locus ID 7112
UniProt ID P42167
Cytogenetics 12q23.1
Protein Families Stem cell - Pluripotency, Transmembrane
MW 38.7 kDa
Gene Summary Through alternative splicing, this gene encodes several distinct LEM domain containing protein isoforms. LEM domain proteins include inner nuclear membrane and intranuclear proteins, and are involved in a variety of cellular functions including gene expression, chromatin organization, and replication and cell cycle control. The encoded alpha isoform is broadly diffuse in the nucleus and contains a lamin binding domain, while the beta and gamma isoforms are localized to the nuclear membrane and contain an HDAC3 interaction domain. The distinct isoforms may compete with each other when acting to chaperone other proteins and regulate transcription. [provided by RefSeq, Aug 2019]
Transcript Variant: This (3) differs at the 3' end compared to variant 1, resulting in a shorter isoform (gamma) with a distinct C-terminus compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.