EPM2A (NM_001018041) Human Untagged Clone

CAT#: SC302137

EPM2A (untagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2


  "NM_001018041" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


EPM2A rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "EPM2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPM2A
Synonyms EPM2; MELF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302137 representing NM_001018041.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTTCCGCTTTGGGGTGGTGGTGCCACCCGCCGTGGCCGGCGCCCGGCCGGAGCTGCTGGTGGTG
GGGTCGCGGCCCGAGCTGGGGCGTTGGGAGCCGCGCGGTGCCGTCCGCCTGAGGCCGGCCGGCACCGCG
GCGGGCGACGGGGCCCTGGCCCTGCAGGAGCCGGGCCTGTGGCTCGGGGAGGTGGAGCTGGCGGCCGAG
GAGGCGGCGCAGGACGGGGCGGAGCCGGGCCGCGTGGACACGTTCTGGTACAAGTTCCTGAAGCGGGAG
CCGGGAGGAGAGCTCTCCTGGGAAGGCAATGGACCTCATCATGACCGTTGCTGTACTTACAATGAAAAC
AACTTGGTGGATGGTGTGTATTGTCTCCCAATAGGACACTGGATTGAGGCCACTGGGCACACCAATGAA
ATGAAGCACACAACAGACTTCTATTTTAATATTGCAGGCCACCAAGCCATGCATTATTCAAGAATTCTA
CCAAATATCTGGCTGGGTAGCTGCCCTCGTCAGGTGGAACATGTAACCATCAAACTGAAGCATGAATTG
GGGATTACAGCTGTAATGAATTTCCAGACTGAATGGGATATTGTACAGAATTCCTCAGGCTGTAACCGC
TACCCAGAGCCCATGACTCCAGACACTATGATTAAACTATATAGGGAAGAAGGCTTGGCCTACATCTGG
ATGCCAACACCAGATATGAGCACCGAAGGCCGAGTACAGATGCTGCCCCAGGCGGTGTGCCTGCTGCAT
GCGCTGCTGGAGAAGGGACACATCGTGTACGTGCACTGCAACGCTGGGGTGGGCCGCTCCACCGCGGCT
GTCTGCGGCTGGCTCCAGTATGTGATGGGCTGGAATCTGAGGAAGGTGCAGTATTTCCTCATGGCCAAG
AGGCCGGCTGTCTACATTGACGAAGAGGCAGCTAGCCAGGACACATTTCCACTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001018041
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018041.1
RefSeq Size 1711 bp
RefSeq ORF 954 bp
Locus ID 7957
UniProt ID O95278
Cytogenetics 6q24.3
Protein Families Druggable Genome, Phosphatase
MW 35.5 kDa
Gene Summary This gene encodes a dual-specificity phosphatase and may be involved in the regulation of glycogen metabolism. The protein acts on complex carbohydrates to prevent glycogen hyperphosphorylation, thus avoiding the formation of insoluble aggregates. Loss-of-function mutations in this gene have been associated with Lafora disease, a rare, adult-onset recessive neurodegenerative disease, which results in myoclonus epilepsy and usually results in death several years after the onset of symptoms. The disease is characterized by the accumulation of insoluble particles called Lafora bodies, which are derived from glycogen. [provided by RefSeq, Jan 2018]
Transcript Variant: This variant (2) lacks a segment of the coding region compared to variant 1. The resulting isoform (b), also known as C-terISO, contains a shorter and distinct C-terminus compared to isoform a. Isoform b has been localized to the nucleus.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.