TPM1 (NM_001018006) Human Untagged Clone

CAT#: SC302120

TPM1 (untagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 4


  "NM_001018006" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Anti-TPM1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00

Other products for "TPM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TPM1
Synonyms C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302120 representing NM_001018006.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAG
CAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTGGAAGATGAGCTGGTGTCACTG
CAAAAGAAACTCAAGGGCACCGAAGATGAACTGGACAAATACTCTGAGGCTCTCAAAGATGCCCAGGAG
AAGCTGGAGCTGGCAGAGAAAAAGGCCACCGATGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATC
CAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAA
GCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAA
GAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAA
TATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAG
CTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTA
ATGGCTGCAGAGGATAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGAC
AAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATT
GATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAG
ACTTTACTGGAGTTAAACAACATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001018006
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001018006.1
RefSeq Size 1797 bp
RefSeq ORF 855 bp
Locus ID 7168
UniProt ID P09493
Cytogenetics 15q22.2
Protein Families Druggable Genome
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
MW 32.9 kDa
Gene Summary This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (Tpm1.7, also known as variant 4) contains alternate, in-frame exons in the 3' coding region, compared to variant Tpm1.1. It encodes isoform Tpm1.7cy, also known as the TM-3 fibroblast isoform, which has a distinct C-terminus, compared to isoform Tpm1.1st.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.