Aurora C (AURKC) (NM_001015879) Human Untagged Clone

CAT#: SC302004

AURKC (untagged)-Human aurora kinase C (AURKC), transcript variant 2


  "NM_001015879" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-AURKC mouse monoclonal antibody, clone OTI10A7 (formerly 10A7)
    • 100 ul

USD 224.00 USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Aurora C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Aurora C
Synonyms AIE2; AIK3; ARK3; AurC; aurora-C; HEL-S-90; SPGF5; STK13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302004 representing NM_001015879.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTACAGCAAACCAAACAGCCCAGCAGCCCAGCAGCCCAGCCATGCGGCGCCTCACAGTCGATGAC
TTTGAAATCGGGCGTCCCCTGGGCAAGGGGAAATTTGGGAATGTGTACCTGGCTCGGCTCAAGGAAAGC
CATTTCATTGTGGCCCTGAAGGTTCTCTTCAAGTCGCAGATAGAGAAGGAAGGACTGGAGCACCAGCTG
CGCCGGGAAATTGAGATCCAGGCTCATCTACAACACCCCAATATCCTGCGCCTGTATAACTATTTCCAT
GATGCACGCCGGGTGTACCTGATTCTGGAATATGCTCCAAGGGGTGAGCTCTACAAGGAGCTGCAGAAA
AGCGAGAAATTAGATGAACAGCGCACAGCCACGATAATAGAGGAGTTGGCAGATGCCCTGACCTACTGC
CATGACAAGAAAGTGATTCACAGAGATATTAAGCCAGAGAACCTGCTGCTGGGGTTCAGGGGTGAGGTG
AAGATTGCAGATTTTGGCTGGTCTGTGCACACCCCCTCCCTGAGGAGGAAGACAATGTGTGGGACACTG
GACTACTTGCCGCCAGAAATGATTGAGGGGAGAACATATGATGAAAAGGTGGATTTGTGGTGCATTGGA
GTGCTCTGCTATGAGCTGCTGGTGGGATATCCACCCTTTGAGAGCGCCTCCCACAGTGAGACTTACAGA
CGCATCCTCAAGGTAGATGTGAGGTTTCCACTATCAATGCCTCTGGGGGCCCGGGACTTGATTTCCAGG
CTTCTCAGATACCAGCCCTTGGAGAGACTGCCCCTGGCCCAGATCCTGAAGCACCCCTGGGTTCAGGCC
CACTCCCGAAGGGTGCTGCCTCCCTGTGCTCAGATGGCTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001015879
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015879.1
RefSeq Size 1120 bp
RefSeq ORF 873 bp
Locus ID 6795
UniProt ID Q9UQB9
Cytogenetics 19q13.43
Protein Families Druggable Genome, Protein Kinase
MW 33.7 kDa
Gene Summary This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also known as Aurora C-SV, uses an alternate splice site at the 5' end of the first intron and an alternate upstream translation initiation site, compared to variant 1. The encoded protein (isoform 2) contains a shorter and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.