BAG5 (NM_001015049) Human Untagged Clone

CAT#: SC301989

BAG5 (untagged)-Human BCL2-associated athanogene 5 (BAG5), transcript variant 1


  "NM_001015049" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
BAG5 mouse monoclonal antibody,clone OTI2D6
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BAG5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BAG5
Synonyms BAG-5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC301989 sequence for NM_001015049 edited (data generated by NextGen Sequencing)


ATGCGTTTCCATTGGTTACCCACCTTGAGCGAGCCGTTTGATAGAAACCAAGAGCTTGAAACGTGCATTA
GGCCGTTGTGGACTCCCAGTGGGAGTGCTTGTGAAACTGAACACAACAAAAGTATGGATATGGGAAACCA
ACATCCTTCTATTAGTAGGCTTCAGGAAATCCAAAAGGAAGTAAAAAGTGTAGAACAGCAAGTTATCGGC
TTCAGTGGTCTGTCAGATGACAAGAATTACAAGAAACTGGAGAGGATTCTAACAAAACAGCTTTTTGAAA
TAGACTCTGTAGATACTGAAGGAAAAGGAGATATTCAGCAAGCTAGGAAGCGGGCAGCACAGGAGACAGA
ACGTCTTCTCAAAGAGTTGGAGCAGAATGCAAACCACCCACACCGGATTGAAATACAGAACATTTTTGAG
GAAGCCCAGTCCCTCGTGAGAGAGAAAATTGTGCCATTTTATAATGGAGGCAACTGCGTAACTGATGAGT
TTGAAGAAGGCATCCAAGATATCATTCTGAGGCTGACACATGTTAAAACTGGAGGAAAAATCTCCTTGCG
GAAAGCAAGGTATCACACTTTAACCAAAATCTGTGCGGTGCAAGAGATAATCGAAGACTGCATGAAAAAG
CAGCCTTCCCTGCCGCTTTCCGAGGATGCACATCCTTCCGTTGCCAAAATCAACTTCGTGATGTGTGAGG
TGAACAAGGCCCGAGGGGTCCTGATTGCACTTCTGATGGGTGTGAACAACAATGAGACCTGCAGGCACTT
ATCCTGTGTGCTCTCGGGGCTGATCGCTGACCTGGATGCTCTAGATGTGTGCGGCCGGACAGAAATCAGA
AATTATCGGAGGGAGGTAGTAGAAGATATCAACAAATTATTGAAATATCTGGATTTGGAAGAGGAAGCAG
ACACAACTAAAGCATTTGACCTGAGACAGAATCATTCCATTTTAAAAATAGAAAAGGTCCTCAAGAGAAT
GAGAGAAATAAAAAATGAACTTCTCCAAGCACAAAACCCTTCTGAATTGTACCTGAGCTCCAAAACAGAA
TTGCAGGGTTTAATTGGACAGTTGGATGAGGTAAGTCTTGAAAAAAACCCCTGCATCCGGGAAGCCAGGA
GAAGAGCAGTGATCGAGGTGCAAACTCTGATCACATATATTGACTTGAAGGAGGCCCTTGAGAAAAGAAA
GCTGTTTGCTTGTGAGGAGCACCCATCCCATAAAGCCGTCTGGAACGTCCTTGGAAACTTGTCTGAGATC
CAGGGAGAAGTTCTTTCATTTGATGGAAATCGAACCGATAAGAACTACATCCGGCTGGAAGAGCTGCTCA
CCAAGCAGCTGCTAGCCCTGGATGCTGTTGATCCGCAGGGAGAAGAGAAGTGTAAGGCTGCCAGGAAACA
AGCTGTGAGGCTTGCGCAGAATATTCTCAGCTATCTCGACCTGAAATCTGATGAATGGGAGTACTGA


Clone variation with respect to NM_001015049.2
75:g=>a
Restriction Sites Please inquire     
ACCN NM_001015049
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015049.1, NP_001015049.1
RefSeq Size 5073 bp
RefSeq ORF 1467 bp
Locus ID 9529
UniProt ID Q9UL15
Cytogenetics 14q32.33
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.