PAK4 (NM_001014835) Human Untagged Clone

CAT#: SC301963

PAK4 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 4 (PAK4), transcript variant 4


  "NM_001014835" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PAK4 mouse monoclonal antibody, clone OTI1C7 (formerly 1C7)
    • 100 ul

USD 478.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PAK4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAK4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001014835, the custom clone sequence may differ by one or more nucleotides
ATGTTTGGGAAGAGGAAGAAGCGGGTGGAGATCTCCGCGCCGTCCAACTTCGAGCACCGC
GTGCACACGGGCTTCGACCAGCACGAGCAGAAGTTCACGGGGCTGCCCCGCCAGTGGCAG
AGCCTGATCGAGGAGTCGGCTCGCCGGCCCAAGCCCCTCGTCGACCCCGCCTGCATCACC
TCCATCCAGCCCGGGGCCCCCAAGGGGGAGCCTCATGACGTGGCCCCTAACGGGCCATCA
GCGGGGGGCCTGGCCATCCCCCAGTCCTCCTCCTCCTCCTCCCGGCCTCCCACCCGAGCC
CGAGGTGCCCCCAGCCCTGGAGTGCTGGGACCCCACGCCTCAGAGCCCCAGCTGGCCCCT
CCAGCCTGCACCCCCGCCGCCCCTGCTGTTCCTGGGCCCCCTGGCCCCCGCTCACCACAG
CGGGAGCCACAGCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGAC
CCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGC
ATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGAC
CTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTAC
CAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTG
GTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAAC
GAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCC
CAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCCTGCTGACCCATGATGGCAGG
GTGAAGCTGTCAGACTTTGGGTTCTGCGCCCAGGTGAGCAAGGAAGTGCCCCGAAGGAAG
TCGCTGGTCGGCACGCCCTACTGGATGGCCCCAGAGCTCATCTCCCGCCTTCCCTACGGG
CCAGAGGTAGACATCTGGTCGCTGGGGATAATGGTGATTGAGATGGTGGACGGAGAGCCC
CCCTACTTCAACGAGCCACCCCTCAAAGCCATGAAGATGATTCGGGACAACCTGCCACCC
CGACTGAAGAACCTGCACAAGGTGTCGCCATCCCTGAAGGGCTTCCTGGACCGCCTGCTG
GTGCGAGACCCTGCCCAGCGGGCCACGGCAGCCGAGCTGCTGAAGCACCCATTCCTGGCC
AAGGCAGGGCCGCCTGCCAGCATCGTGCCCCTCATGCGCCAGAACCGCACCAGATGA
Restriction Sites Please inquire     
ACCN NM_001014835
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014835.1, NP_001014835.1
RefSeq Size 2379 bp
RefSeq ORF 1317 bp
Locus ID 10298
UniProt ID O96013
Cytogenetics 19q13.2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Axon guidance, ErbB signaling pathway, Focal adhesion, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway
Gene Summary PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks an in-frame exon in the coding region, as compared to variant 1. The encoded isoform (2) thus lacks an internal segment, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.