DCTD (NM_001012732) Human Untagged Clone

CAT#: SC301714

DCTD (untagged)-Human dCMP deaminase (DCTD), transcript variant 1


  "NM_001012732" in other vectors (4)

Reconstitution Protocol

USD 480.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


DCTD rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "DCTD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DCTD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301714 representing NM_001012732.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGGCGGGGGCCAGCCGTGCGGACCCAACATGAGTGAAGTTTCCTGCAAGAAACGGGACGACTAT
TTGGAATGGCCAGAGTATTTTATGGCTGTGGCCTTCTTATCAGCACAGAGAAGCAAAGATCCAAATTCC
CAGGTCGGCGCCTGCATCGTGAATTCAGAAAACAAGATTGTCGGGATTGGGTACAATGGGATGCCAAAT
GGGTGCAGTGATGACGTGTTGCCTTGGAGAAGGACAGCAGAGAATAAGCTGGACACCAAATACCCGTAC
GTGTGCCATGCGGAGCTGAATGCCATCATGAACAAAAATTCGACCGATGTGAAAGGCTGTAGTATGTAT
GTTGCCTTGTTCCCTTGTAATGAATGCGCTAAGCTCATCATCCAGGCAGGTATAAAAGAAGTGATTTTC
ATGTCTGATAAATACCATGATAGTGACGAGGCAACTGCTGCGAGGCTCCTGTTTAATATGGCCGGGGTG
ACATTCCGGAAATTCATACCGAAGTGCAGCAAGATTGTCATTGACTTTGATTCAATTAACAGCAGACCG
AGTCAAAAGCTTCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001012732
Insert Size 570 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012732.1
RefSeq Size 2042 bp
RefSeq ORF 570 bp
Locus ID 1635
UniProt ID P32321
Cytogenetics 4q35.1
Protein Pathways Metabolic pathways, Pyrimidine metabolism
MW 21 kDa
Gene Summary The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a). CCDS Note: This CCDS representation is supported by transcript data, including the mRNAs BC088357.1 and AK313221.1. The 5'-most in-frame translational start codon is annotated, but it should be noted that this start codon is specific to primate species. This start codon also has a weak Kozak signal, and thus it is possible that leaky scanning by the ribosome will sometimes occur to allow initiation at a downstream start codon. The downstream start codon has a stronger Kozak signal and is much more widely conserved. Translation from the downstream start codon would result in a protein that is 11 aa shorter at the N-terminus. An alternative 5' end variant that encodes the shorter protein is represented by CCDS3831.1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.