BUB3 (NM_001007793) Human Untagged Clone

CAT#: SC301252

BUB3 (untagged)-Human budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3), transcript variant 2


  "NM_001007793" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-BUB3 Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BUB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BUB3
Synonyms BUB3L; hBUB3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301252 representing NM_001007793.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCGGTTCTAACGAGTTCAAGCTGAACCAGCCACCCGAGGATGGCATCTCCTCCGTGAAGTTCAGC
CCCAACACCTCCCAGTTCCTGCTTGTCTCCTCCTGGGACACGTCCGTGCGTCTCTACGATGTGCCGGCC
AACTCCATGCGGCTCAAGTACCAGCACACCGGCGCCGTCCTGGACTGCGCCTTCTACGATCCAACGCAT
GCCTGGAGTGGAGGACTAGATCATCAATTGAAAATGCATGATTTGAACACTGATCAAGAAAATCTTGTT
GGGACCCATGATGCCCCTATCAGATGTGTTGAATACTGTCCAGAAGTGAATGTGATGGTCACTGGAAGT
TGGGATCAGACAGTTAAACTGTGGGATCCCAGAACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAA
AAGGTATATACCCTCTCAGTGTCTGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTGGTG
TGGGACTTACGGAACATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATACCAGACTCGCTGC
ATACGAGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAAGGCCGAGTGGCAGTTGAGTAT
TTGGACCCAAGCCCTGAGGTACAGAAGAAGAAGTATGCCTTCAAATGTCACAGACTAAAAGAAAATAAT
ATTGAGCAGATTTACCCAGTCAATGCCATTTCTTTTCACAATATCCACAATACATTTGCCACAGGTGGT
TCTGATGGCTTTGTAAATATTTGGGATCCATTTAACAAAAAGCGACTGTGCCAATTCCATCGGTACCCC
ACGAGCATCGCATCACTTGCCTTCAGTAATGATGGGACTACGCTTGCAATAGCGTCATCATATATGTAT
GAAATGGATGACACAGAACATCCTGAAGATGGTATCTTCATTCGCCAAGTGACAGATGCAGAAACAAAA
CCCAAGTCCACCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001007793
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007793.3
RefSeq Size 1374 bp
RefSeq ORF 981 bp
Locus ID 9184
UniProt ID O43684
Cytogenetics 10q26.13
Protein Families Druggable Genome
Protein Pathways Cell cycle
MW 37 kDa
Gene Summary This gene encodes a protein involved in spindle checkpoint function. The encoded protein contains four WD repeat domains and has sequence similarity with the yeast BUB3 protein. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform b which has a shorter and distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.