EPHA8 (NM_001006943) Human Untagged Clone

CAT#: SC301126

EPHA8 (untagged)-Human EPH receptor A8 (EPHA8), transcript variant 2


  "NM_001006943" in other vectors (7)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
EPHA8 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "EPHA8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPHA8
Synonyms EEK; EK3; HEK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301126 representing NM_001006943.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCCCGCCCGGGGCCGCCTGCCCCCTGCGCTCTGGGTCGTCACGGCCGCGGCGGCGGCGGCCACC
TGCGTGTCCGCGGCGCGCGGCGAAGTGAATTTGCTGGACACGTCGACCATCCACGGGGACTGGGGCTGG
CTCACGTATCCGGCTCATGGGTGGGACTCCATCAACGAGGTGGACGAGTCCTTCCAGCCCATCCACACG
TACCAGGTTTGCAACGTCATGAGCCCCAACCAGAACAACTGGCTGCGCACGAGCTGGGTCCCCCGAGAC
GGCGCCCGGCGCGTCTATGCTGAGATCAAGTTTACCCTGCGCGACTGCAACAGCATGCCTGGTGTGCTG
GGCACCTGCAAGGAGACCTTCAACCTCTACTACCTGGAGTCGGACCGCGACCTGGGGGCCAGCACACAA
GAAAGCCAGTTCCTCAAAATCGACACCATTGCGGCCGACGAGAGCTTCACAGGTGCCGACCTTGGTGTG
CGGCGTCTCAAGCTCAACACGGAGGTGCGCAGTGTGGGTCCCCTCAGCAAGCGCGGCTTCTACCTGGCC
TTCCAGGACATAGGTGCCTGCCTGGCCATCCTCTCTCTCCGCATCTACTATAAGAAGTGCCCTGCCATG
GTGCGCAATCTGGCTGCCTTCTCGGAGGCAGTGACGGGGGCCGACTCGTCCTCACTGGTGGAGGTGAGG
GGCCAGTGCGTGCGGCACTCAGAGGAGCGGGACACACCCAAGATGTACTGCAGCGCGGAGGGCGAGTGG
CTCGTGCCCATCGGCAAATGCGTGTGCAGTGCCGGCTACGAGGAGCGGCGGGATGCCTGTGTGGCCTGT
GAGCTGGGCTTCTACAAGTCAGCCCCTGGGGACCAGCTGTGTGCCCGCTGCCCTCCCCACAGCCACTCC
GCAGCTCCAGCCGCCCAAGCCTGCCACTGTGACCTCAGCTACTACCGTGCAGCCCTGGACCCGCCGTCC
TCAGCCTGCACCCGGCCACCCTCGGCACCAGTGAACCTGATCTCCAGTGTGAATGGGACATCAGTGACT
CTGGAGTGGGCCCCTCCCCTGGACCCAGGTGGCCGCAGTGACATCACCTACAATGCCGTGTGCCGCCGC
TGCCCCTGGGCACTGAGCCGCTGCGAGGCATGTGGGAGCGGCACCCGCTTTGTGCCCCAGCAGACAAGC
CTGGTGCAGGCCAGCCTGCTGGTGGCCAACCTGCTGGCCCACATGAACTACTCCTTCTGGATCGAGGCC
GTCAATGGCGTGTCCGACCTGAGCCCCGAGCCCCGCCGGGCCGCTGTGGTCAACATCACCACGAACCAG
GCAGGTAGGCGGAGAAACTCCGTCCCGCAGCGTCCTGGTCCCCCAGCTTCCCCTGCCTCAGACCCATCC
AGGGATCAGAGCTCTGCCGGGGACGTGCTGTGGGCCTTTAGGCAAGTGCCTCTCTGGCCCTGCGCTCCT
CACCAGGACCCAGAGCTGGAGGCTCTTCATTGCCTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006943
Insert Size 1488 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006943.1
RefSeq Size 1866 bp
RefSeq ORF 1488 bp
Locus ID 2046
UniProt ID P29322
Cytogenetics 1p36.12
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Axon guidance
MW 53.9 kDa
Gene Summary This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2, which has a shorter and distinct C-terminus compared to isoform 1. This transcript is supported by mRNA transcripts but the predicted ORF and its predicted precursor sequence have not yet been experimentally confirmed.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.