FMO3 (NM_001002294) Human Untagged Clone

CAT#: SC300436

FMO3 (untagged)-Human flavin containing monooxygenase 3 (FMO3), transcript variant 2


  "NM_001002294" in other vectors (4)

Reconstitution Protocol

USD 546.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
FMO3 mouse monoclonal antibody, clone OTI3H1 (formerly 3H1)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FMO3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FMO3
Synonyms dJ127D3.1; FMOII; TMAU
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300436 representing NM_001002294.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAGAAAGTGGCCATCATTGGAGCTGGTGTGAGTGGCTTGGCCTCCATCAGGAGCTGTCTGGAA
GAGGGGCTGGAGCCCACCTGCTTTGAGAAGAGCAATGACATTGGGGGCCTGTGGAAATTTTCAGACCAT
GCAGAGGAGGGCAGGGCTAGCATTTACAAATCAGTCTTTTCCAACTCTTCCAAAGAGATGATGTGTTTC
CCAGACTTCCCATTTCCCGATGACTTCCCCAACTTTATGCACAACAGCAAGATCCAGGAATATATCATT
GCATTTGCCAAAGAAAAGAACCTCCTGAAGTACATACAATTTAAGACATTTGTATCCAGTGTAAATAAA
CATCCTGATTTTGCAACTACTGGCCAGTGGGATGTTACCACTGAAAGGGATGGTAAAAAAGAATCGGCT
GTCTTTGATGCTGTAATGGTTTGTTCCGGACATCATGTGTATCCCAACCTACCAAAAGAGTCCTTTCCA
GGACTAAACCACTTTAAAGGCAAATGCTTCCACAGCAGGGACTATAAAGAACCAGGTGTATTCAATGGA
AAGCGTGTCCTGGTGGTTGGCCTGGGGAATTCGGGCTGTGATATTGCCACAGAACTCAGCCGCACAGCA
GAACAGGTCATGATCAGTTCCAGAAGTGGCTCCTGGGTGATGAGCCGGGTCTGGGACAATGGTTATCCT
TGGGACATGCTGCTCGTCACTCGATTTGGAACCTTCCTCAAGAACAATTTACCGACAGCCATCTCTGAC
TGGTTGTACGTGAAGCAGATGAATGCAAGATTCAAGCATGAAAACTATGGCTTGATGCCTTTAAATGGA
GTCCTGAGGAAAGAGCCTGTATTTAACGATGAGCTCCCAGCAAGCATTCTGTGTGGCATTGTGTCCGTA
AAGCCTAACGTGAAGGAATTCACAGAGACCTCGGCCATTTTTGAGGATGGGACCATATTTGAGGGCATT
GACTGTGTAATCTTTGCAACAGGGTATAGTTTTGCCTACCCCTTCCTTGATGAGTCTATCATCAAAAGC
AGAAACAATGAGATCATTTTATTTAAAGGAGTATTTCCTCCTCTACTTGAGAAGTCAACCATAGCAGTG
ATTGGCTTTGTCCAGTCCCTTGGGGCTGCCATTCCCACAGTTGACCTCCAGTCCCGCTGGGCAGCACAA
GTAATAAAGGGAACTTGTACTTTGCCTTCTATGGAAGACATGATGAATGATATTAATGAGAAAATGGAG
AAAAAGCGCAAATGGTTTGGCAAAAGCGAGACCATACAGACAGATTACATTGTTTATATGGATGAACTC
TCCTCCTTCATTGGGGCAAAGCCCAACATCCCATGGCTGTTTCTCACAGATCCCAAATTGGCCATGGAA
GTTTATTTTGGCCCTTGTAGTCCCTACCAGTTTAGGCTGGTGGGCCCAGGGCAGTGGCCAGGAGCCAGA
AATGCCATACTGACCCAGTGGGACCGGTCGTTGAAACCCATGCAGACACGAGTGGTCGGGAGACTTCAG
AAGCCTTGCTTCTTTTTCCATTGGCTGAAGCTCTTTGCAATTCCTATTCTGTTAATCGCTGTTTTCCTT
GTGTTGACCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002294
Insert Size 1599 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002294.2
RefSeq Size 2107 bp
RefSeq ORF 1599 bp
Locus ID 2328
UniProt ID P31513
Cytogenetics 1q24.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450
MW 60 kDa
Gene Summary Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Transcript Variant: This variant (2) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.