CD32B (FCGR2B) (NM_001002274) Human Untagged Clone

CAT#: SC300433

FCGR2B (untagged)-Human Fc fragment of IgG, low affinity IIb, receptor (CD32) (FCGR2B), transcript variant 3


  "NM_001002274" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-FCGR2B Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD32B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD32B
Synonyms CD32; CD32B; FCG2; FCGR2; FCGR2C; FcRII-c; IGFR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300433 representing NM_001002274.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAATCCTGTCATTCTTACCTGTCCTTGCCACTGAGAGTGACTGGGCTGACTGCAAGTCCCCCCAG
CCTTGGGGTCATATGCTTCTGTGGACAGCTGTGCTATTCCTGGCTCCTGTTGCTGGGACACCTGCAGCT
CCCCCAAAGGCTGTGCTGAAACTCGAGCCCCAGTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTG
ACATGCCGGGGGACTCACAGCCCTGAGAGCGACTCCATTCAGTGGTTCCACAATGGGAATCTCATTCCC
ACCCACACGCAGCCCAGCTACAGGTTCAAGGCCAACAACAATGACAGCGGGGAGTACACGTGCCAGACT
GGCCAGACCAGCCTCAGCGACCCTGTGCATCTGACTGTGCTTTCTGAGTGGCTGGTGCTCCAGACCCCT
CACCTGGAGTTCCAGGAGGGAGAAACCATCGTGCTGAGGTGCCACAGCTGGAAGGACAAGCCTCTGGTC
AAGGTCACATTCTTCCAGAATGGAAAATCCAAGAAATTTTCCCGTTCGGATCCCAACTTCTCCATCCCA
CAAGCAAACCACAGTCACAGTGGTGATTACCACTGCACAGGAAACATAGGCTACACGCTGTACTCATCC
AAGCCTGTGACCATCACTGTCCAAGCTCCCAGCTCTTCACCGATGGGGATCATTGTGGCTGTGGTCACT
GGGATTGCTGTAGCGGCCATTGTTGCTGCTGTAGTGGCCTTGATCTACTGCAGGAAAAAGCGGATTTCA
GCCAATCCCACTAATCCTGATGAGGCTGACAAAGTTGGGGCTGAGAACACAATCACCTATTCACTTCTC
ATGCACCCGGATGCTCTGGAAGAGCCTGATGACCAGAACCGTATTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002274
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002274.2
RefSeq Size 2117 bp
RefSeq ORF 876 bp
Locus ID 2213
UniProt ID P31994
Cytogenetics 1q23.3
Protein Families ES Cell Differentiation/IPS, Transmembrane
Protein Pathways B cell receptor signaling pathway, Fc gamma R-mediated phagocytosis, Systemic lupus erythematosus
MW 31.9 kDa
Gene Summary The protein encoded by this gene is a low affinity receptor for the Fc region of immunoglobulin gamma complexes. The encoded protein is involved in the phagocytosis of immune complexes and in the regulation of antibody production by B-cells. Variations in this gene may increase susceptibilty to systemic lupus erythematosus (SLE). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.