JPT1 (NM_001002032) Human Untagged Clone
CAT#: SC300399
HN1 (untagged)-Human hematological and neurological expressed 1 (HN1), transcript variant 2
"NM_001002032" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | JPT1 |
Synonyms | ARM2; HN1; HN1A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001002032, the custom clone sequence may differ by one or more nucleotides
ATGACCACAACCACCACCTTCAAGGGAGTCGACCCCAACAGCAGGAATAGCTCCCGAGTT TTGCGGCCTCCAGGTGGTGGATCCAATTTTTCATTAGGTTTTGATGAACCAACAGAACAA CCTGTGAGGAAGAACAAAATGGCCTCTAATATCTTTGGGACACCTGAAGAAAATCAAGCT TCTTGGGCCAAGTCAGCAGGTGCCAAGTCTAGTGGTGGCAGGGAAGACTTGGAGTCATCT GGACTGCAGAGAAGGAACTCCTCTGAAGCAAGCTCCGGAGACTTCTTAGATCTGAAGAAA ATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTG CGCCTGTGCCCAGCCCGGTGGCCCCGGCCCCAGTGCCATCCAGAAGAAATCCCCCTGGCG GCAAGTCCAGCCTCGTCTTGGGTTAGCTCTGACTGTCCTGAACGCTGTCGTTCTGTCTGT TTCCTCCATGCTTGTGAACTGCACAACTTGAGCCTGACTGTACATCTCTTGGATTTGTTT CATTAA |
Restriction Sites | Please inquire |
ACCN | NM_001002032 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001002032.1, NP_001002032.1 |
RefSeq Size | 1582 bp |
RefSeq ORF | 546 bp |
Locus ID | 51155 |
UniProt ID | Q9UK76 |
Cytogenetics | 17q25.1 |
Gene Summary | Modulates negatively AKT-mediated GSK3B signaling (PubMed:21323578, PubMed:22155408). Induces CTNNB1 'Ser-33' phosphorylation and degradation through the suppression of the inhibitory 'Ser-9' phosphorylation of GSK3B, which represses the function of the APC:CTNNB1:GSK3B complex and the interaction with CDH1/E-cadherin in adherent junctions (PubMed:25169422). Plays a role in the regulation of cell cycle and cell adhesion (PubMed:25169422, PubMed:25450365). Has an inhibitory role on AR-signaling pathway through the induction of receptor proteosomal degradation (PubMed:22155408).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) encodes the longest isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224807 | HN1 (Myc-DDK-tagged)-Human hematological and neurological expressed 1 (HN1), transcript variant 2 |
USD 330.00 |
|
RC224807L3 | Lenti-ORF clone of HN1 (Myc-DDK-tagged)-Human hematological and neurological expressed 1 (HN1), transcript variant 2 |
USD 630.00 |
|
RC224807L4 | Lenti-ORF clone of HN1 (mGFP-tagged)-Human hematological and neurological expressed 1 (HN1), transcript variant 2 |
USD 630.00 |
|
RG224807 | HN1 (tGFP-tagged) - Human hematological and neurological expressed 1 (HN1), transcript variant 2 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review