GMPR2 (NM_001002002) Human Untagged Clone

CAT#: SC300385

GMPR2 (untagged)-Human guanosine monophosphate reductase 2 (GMPR2), transcript variant 4


  "NM_001002002" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-GMPR2 Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GMPR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GMPR2
Synonyms GMPR 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300385 representing NM_001002002.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCATATTGACAACGATGTGAAACTGGACTTCAAGGATGTCCTTTTGAGGCCCAAACGCAGTACC
CTTAAGTCTCGAAGTGAGGTGGATCTCACAAGATCCTTTTCATTTCGGAACTCAAAGCAGACATACTCT
GGGGTTCCCATCATTGCTGCCAATATGGATACTGTGGGCACCTTTGAGATGGCCAAGGTTCTCTGTAAG
TTCTCTCTCTTCACTGCTGTCCATAAGCACTATAGCCTCGTTCAGTGGCAAGAGTTTGCTGGCCAGAAT
CCTGACTGTCTTGAGCATCTGGCTGCCAGCTCAGGCACAGGCTCTTCTGACTTTGAGCAGCTGGAACAG
ATCCTGGAAGCTATTCCCCAGGTGAAGTATATATGCCTGGATGTGGCAAATGGCTACTCTGAACACTTT
GTTGAATTTGTAAAAGATGTACGGAAGCGCTTCCCCCAGCACACCATCATGGCAGGGAATGTGGTAACA
GGAGAGATGGTAGAAGAGCTCATCCTTTCTGGGGCTGACATCATCAAAGTGGGAATTGGGCCAGGCTCT
GTGTGTACTACTCGGAAGAAAACTGGAGTGGGGTATCCACAGCTCAGCGCAGTGATGGAGTGTGCAGAT
GCTGCTCATGGCCTCAAAGGCCACATCATTTCAGATGGAGGTTGCAGCTGTCCTGGGGATGTGGCCAAG
GCTTTTGGGGCAGGAGCTGACTTCGTGATGCTGGGTGGCATGCTGGCTGGGCACAGTGAGTCAGGTGGT
GAGCTCATCGAGAGGGATGGCAAGAAGTACAAGCTCTTCTATGGAATGAGTTCTGAAATGGCCATGAAG
AAGTATGCTGGGGGCGTGGCTGAGTACAGAGCCTCAGAGGGAAAGACAGTGGAAGTTCCTTTTAAAGGA
GATGTGGAACATACCATCCGAGACATCCTAGGAGGGATCCGCTCTACGTGTACCTATGTGGGAGCAGCT
AAGCTCAAAGAGTTGAGCAGGAGAACTACCTTCATCCGAGTCACCCAGCAGGTGAATCCAATCTTCAGT
GAGGCGTGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002002
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001002002.2
RefSeq Size 1669 bp
RefSeq ORF 1047 bp
Locus ID 51292
UniProt ID Q9P2T1
Cytogenetics 14q12
Protein Families Druggable Genome
Protein Pathways Purine metabolism
MW 37.9 kDa
Gene Summary This gene encodes an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of guanosine monophosphate (GMP) to inosine monophosphate (IMP). The protein also functions in the re-utilization of free intracellular bases and purine nucleosides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, and 4 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.