Glutaredoxin 2 (GLRX2) (NM_197962) Human Untagged Clone

CAT#: SC128092

GLRX2 (untagged)-Human glutaredoxin 2 (GLRX2), transcript variant 2


  "NM_197962" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Glutaredoxin 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Glutaredoxin 2
Synonyms CGI-133; GRX2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC128092 sequence for NM_197962 edited (data generated by NextGen Sequencing)
ATGATTTGGCGCCGCGCGGCGCTGGCGGGGACGCGGCTGGTTTGGAGCAGGAGCGGCTCG
GCAGGCTGGCTTGACAGGGCGGCGGGAGCTGCGGGAGCTGCGGCAGCTGCGGCCTCTGGG
ATGGAGAGCAATACATCATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATC
CAAGAAACAATTTCTGATAATTGTGTGGTGATTTTCTCAAAAACATCCTGTTCTTACTGT
ACAATGGCAAAAAAGCTTTTCCATGACATGAATGTTAACTATAAAGTGGTGGAACTGGAC
CTGCTTGAATATGGAAACCAGTTCCAAGATGCTCTTTACAAAATGACTGGTGAAAGAACT
GTTCCAAGAATATTTGTCAATGGTACTTTTATTGGAGGTGCAACTGACACTCATAGGCTT
CACAAAGAAGGAAAATTGCTCCCACTAGTTCATCAGTGTTATTTAAAAAAAAGTAAGAGG
AAAGAATTTCAGTGA

Clone variation with respect to NM_197962.2
>OriGene 5' read for NM_197962 unedited
NGGAGTTCAAATTTGTATACGACTCACTATAGGGCGGCCGCGAATCCCGGGNAATCGTCG
ACCCACGCGTCCGCGCCGCGCGGCGCTGGCGGGGACGCGGCTGGTTTGGAGCAGGAGCGG
CTCGGCAGGCTGGCTTGACAGGGCGGCCGCGAATTCCCGGACCATGATTTGGCGCCGCGC
GGCGCTGGCGGGGACGCGGCTGGTTTGGAGCAGGAGCGGCTCGGCAGGCTGGCTTGACAG
GGCGGCGGGAGCTGCGGGAGCTGCGGCAGCTGCGGCCTCTGGGATGGAGAGCAATACATC
ATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATCCAAGAAACAATTTCTGA
TAATTGTGTGGTGATTTTCTCAAAAACATCCTGTTCTTACTGTACAATGGCAAAAAAGCT
TTTCCATGACATGAATGTTAACTATAAAGTGGTGGAACTGGACCTGCTTGAATATGGAAA
CCAGTTCCAAGATGCTCTTTACAAAATGACTGGTGAAAGAACTGTTCCAAGAATATTTGT
CAATGGTACTTTTATTGGAGGTGCAACTGACACTCATAGGCTTCACAAAGAAGGAAAATT
GCTCCCACTAGTTCATCAGTGTTATTTAAAAAAAAGTAAGAGGAAAGAATTTCAGTGATG
TTTATACTAATAAGTTTGCTAGTACAGTGTCAGTTATTTAAAGTGGTAATGCCCGATAAT
GTCTTTTAAATGTTTGANGATGTTTTAAATACATGCATTGTCTTCACGAAGAAAGATGTA
AAAATATGAACAATANATTGCGGTGGAAACCTCTTAAAAAAAAAAAAAAAGGGCGGCCGC
GGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCCTCCCAGC
Restriction Sites NotI-NotI     
ACCN NM_197962
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_197962.1, NP_932066.1
RefSeq Size 735 bp
RefSeq ORF 495 bp
Locus ID 51022
UniProt ID Q9NS18
Cytogenetics 1q31.2
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses an alternate 5' exon and thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2, also known as Grx2a or mitochondrial Grx2) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.