PKA R2 (PRKAR2A) (NM_004157) Human Untagged Clone

CAT#: SC128044

PRKAR2A (untagged)-Human protein kinase, cAMP-dependent, regulatory, type II, alpha (PRKAR2A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PKA R2
• Synonyms: PKR2; PRKAR2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC128044 sequence for NM_004157 edited (data generated by NextGen Sequencing)
  ATGAGCCACATCCAGATCCCGCCGGGGCTCACGGAGCTGCTGCAGGGCTACACGGTGGAG
  GTGCTGCGACAGCAGCCGCCTGACCTCGTCGAATTCGCAGTGGAGTACTTCACCCGCCTG
  CGCGAGGCCCGCGCCCCAGCCTCAGTCCTGCCCGCCGCCACCCCACGCCAGAGCCTGGGC
  CACCCCCCGCCAGAACCCGGCCCGGACCGTGTCGCCGACGCCAAAGGGGACAGCGAGTCG
  GAGGAGGACGAGGACTTGGAAGTTCCAGTTCCTAGCAGATTTAATAGACGAGTATCAGTC
  TGTGCTGAGACCTATAACCCTGATGAGGAAGAGGAAGATACAGATCCAAGGGTGATTCAT
  CCTAAAACTGATGAACAGAGATGCAGACTTCAGGAAGCTTGCAAAGATATTCTCCTTTTC
  AAAAATCTTGATCAGGAACAGCTTTCTCAAGTTCTCGATGCCATGTTTGAAAGGATAGTC
  AAAGCTGATGAGCATGTCATTGACCAAGGAGATGATGGAGACAACTTTTATGTCATAGAA
  CGGGGAACTTATGACATTTTAGTAACAAAAGATAATCAAACCCGCTCTGTTGGTCAATAT
  GACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAACACCCCGAGAGCTGCTACC
  ATTGTTGCTACCTCAGAAGGCTCCCTTTGGGGACTGGACCGGGTGACTTTTAGAAGAATC
  ATAGTGAAAAATAATGCAAAGAAGAGGAAGATGTTTGAATCATTTATTGAGTCTGTGCCC
  CTCCTTAAATCACTAGAGGTGTCAGAACGAATGGAGATTGTGGATGTAATAGGAGAGAAG
  ATCTATAAGGATGGAGAACGCATAATCACTCAGGGTGAAAAGGCTGATAGCTTTTACATC
  ATAGAGTCTGGCGAAGTGAGCATCTTGATTAGAAGCAGGACTAAATCAAACAAGGATGGT
  GGGAACCAGGAGGTCGAGATTGCCCGCTGCCATAAGGGGCAGTACTTTGGAGAGCTTGCC
  CTGGTCACCAACAAACCCAGAGCTGCCTCAGCTTATGCAGTTGGAGATGTCAAATGCTTA
  GTTATGGATGTACAAGCATTCGAGAGGCTTCTGGGGCCCTGCATGGACATCATGAAGAGG
  AACATCTCACACTATGAGGAACAGCTGGTGAAGATGTTTGGCTCCAGCGTGGATCTGGGC
  AACCTCGGGCAGTAG
  
  Clone variation with respect to NM_004157.2
  814 a=>g
• Restriction Sites: Please inquire
• ACCN: NM_004157
• Insert Size: 3000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: A TrueClone.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004157.2, NP_004148.1
• RefSeq Size: 2381 bp
• RefSeq ORF: 1215 bp
• Locus ID: 5576
• UniProt ID: P13861
• Cytogenetics: 3p21.31
• Domains: cNMP, RIIa
• Protein Families: Druggable Genome
• Protein Pathways: Apoptosis, Insulin signaling pathway
• Gene Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]