C19orf12 (NM_031448) Human Untagged Clone

CAT#: SC127755

C19orf12 (untagged)-Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2


  "NM_031448" in other vectors (7)

Reconstitution Protocol

USD 1,335.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "C19orf12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C19orf12
Synonyms MPAN; NBIA3; NBIA4; SPG43
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_031448, the custom clone sequence may differ by one or more nucleotides


ATGACTATCATGGTGGAGGACATCATGAAGCTGCTGTGCTCCCTTTCTGGGGAGAGGAAGATGAAGGCGG
CTGTCAAGCACTCTGGGAAGGGTGCCCTGGTCACAGGGGCCATGGCCTTCGTCGGGGGTTTGGTGGGCGG
CCCACCGGGACTCGCCGTTGGGGGGGCTGTCGGGGGGCTGTTAGGTGCCTGGATGACAAGTGGACAGTTT
AAGCCGGTTCCTCAGATCCTAATGGAGCTGCCCCCTGCCGAGCAACAGAGGCTCTTTAACGAAGCCGCAG
CCATCATCAGGCACCTGGAGTGGACGGACGCCGTGCAGCTGACCGCGCTGGTCATGGGCAGCGAGGCCCT
GCAGCAGCAGCTGCTGGCCATGCTGGTGAACTACGTCACCAAGGAGCTGCGGGCCGAGATCCAGTATGAT
GACTAG


>OriGene 5' read for NM_031448 unedited
CCGCGAATTCGGCACGAGCCGGGCTGCAGCCGCGTCTGATCGCCGAGCGCGCCGCGTAGA
CCTCCGCTCCCCCAGGCCCGCCACGATGACTATCATGGTGGAGGACATCATGAAGCTGCT
GTGCTCCCTTTCTGGGGAGAGGAAGATGAAGGCGGCTGTCAAGCACTCTGGGAAGGGTGC
CCTGGTCACAGGGGCCATGGCCTTCGTCGGGGGTTTGGTGGGCGGCCCACCGGGACTCGC
CGTTGGATCCAGTCTAAGACACCGCATTGCATTGAATCGCCTGCTTTCTTAGTCTCCTCT
GGCCTTTAACACTTTCTCAGACTTGCCTTGTTCACAGCCTTGATAGTTTTGAGGAGTACT
GGGCAGGGGGGGCTGTCGGGGGGCTGTTAGGTGCCTGGATGACAAGTGGACAGTTTAAGC
CGGTTCCTCAGATCCTAATGGAGCTGCCCCCTGCCGAGCAACAGAGGCTCTTTAACGAAG
CCGCAGCCATCATCAGGCACCTGGAGTGGACGGACGCCGTGCAGCTGACCGCGCTGGTCA
TGGGCAGCGAGGCCCTGCAGCAGCAGCTGCTGGCCATGCTGGTGAACTACGTCACCAAGG
AGCTGCGGGCCGAGATCCAGTATGATGACTANNGCCGCACCTCGGNGAGGTGGGNGGGCC
CCTTTAATGACTCTGTGATTCTGAGAGGTGCTTGGGAGTTGGAGAGCCCCACGATGCCCC
TGGGGATCTCACATCATCAGTGTTTAT
Restriction Sites NotI-NotI     
ACCN NM_031448
Insert Size 3670 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_031448.2, NP_113636.1
RefSeq Size 4683 bp
RefSeq ORF 4683 bp
Locus ID 83636
UniProt ID Q9NSK7
Cytogenetics 19q12
Protein Families Transmembrane
Gene Summary This gene encodes a small transmembrane protein. Mutations in this gene are a cause of neurodegeneration with brain iron accumulation-4 (NBIA4), but the specific function of the encoded protein is unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 2 and 4 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.