ARPP21 (NM_198399) Human Untagged Clone

CAT#: SC127508

ARPP21 (untagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 2


  "NM_198399" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-ARPP21 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ARPP21"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARPP21
Synonyms ARPP-21; R3HDM3; RCS; TARPP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC127508 sequence for NM_198399 edited (data generated by NextGen Sequencing)
ATGTCTGAGCAAGGAGACCTGAATCAGGCAATAGCAGAGGAAGGAGGGACTGAGCAGGAG
ACGGCCACTCCAGAGAACGGCATTGTTAAATCAGAAAGTCTGGATGAAGAGGAGAAACTG
GAACTGCAGAGGCGGCTGGAGGCTCAGAATCAAGAAAGAAGAAAATCCAAGTCAGGAGCA
GGAAAAGGTAAACTGACTCGCAGTCTTGCTGTCTGTGAGGAATCTTCTGCCAGACCAGGA
GGTGAAAGTCTTCAGGATCAGACTCTCTGA

Clone variation with respect to NM_198399.1
204 c=>t
>OriGene 5' read for NM_198399 unedited
TACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGCAGCTTGAGACAGGTGGAG
CTGGATCAAGCTGTGAACGTGATTTGCTGGAAGCTGGTTGACGATGTGTCACACTGTGTA
AGGGAATCGCATGGAGATGGGCATTCCGAACTGTTAATGGGGACATGGGACTCCAGTTGT
CTCTGATCACTTGTGTGGATTTTCCTGGCGTAGAACGACAGAAGCCGCTAGTAAGTCGCC
AAGACCTACAGCAGGAATTCTGCACCAAAGGGCATAAAATCTTGTTATTTTAATTTGCAT
CTGGGAGAATGTCTGAGCAAGGAGACCTGAATCAGGCAATAGCAGAGGAAGGAGGGACTG
AGCAGGAGACGGCCACTCCAGAGAACGGCATTGTTAAATCAGAAAGTCTGGATGAAGAGG
AGAAACTGGAACTGCAGAGGCGGCTGGAGGCTCAGAATCAAGAAAGAAGAAAATCCAAGT
CAGGAGCAGGAAAAGGTAAACTGACTCGCAGTCTTGCTGTCTGTGAGGAATCTTCTGCCA
GACCAGGAGGTGAAAGTCTTCAGGATCAGACTCTCTGAAAACTGCAAATGGAAAGGAATT
CAAAAGAATTTAGATTAAAAGTTAAATAAAAAGTAGGCACAGTAGTGCTGAATTTTCCTC
AAAGGCTCTCTTTTGATAAGGCTGAACCAAATATATCCCAAGTATCCTCTCTTCTTCCTT
GTTGGAGATGTCTTACCTCTCAGCTNCCCAAATGCACTTGCCTATAAGAACACANTNGCT
NGTNTCATATGAACTTAGNAATAGTGAATAAGGTGCATTAACTTGAGAATACTTTATGGG
CTTGTGGAGATTCTCATCTGCAAAAGTGTCAAAAGATCTGACTGAGGGACTTAAGTAATA
TATATAATACTGCTATTTTACCTTATTTGCTCTCACAGATTANAG
Restriction Sites NotI-NotI     
ACCN NM_198399
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198399.1, NP_938409.1
RefSeq Size 2413 bp
RefSeq ORF 270 bp
Locus ID 10777
UniProt ID Q9UBL0
Cytogenetics 3p22.3
Gene Summary This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (2) uses an alternate 5' exon and an alternate 3' exon compared to variant 1. The resulting isoform (2) has a distinct and much shorter C-terminus compared to isoform 1. Variants 2, 3, 4, 5 and 7 all encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.