CAMK2D (NM_172128) Human Untagged Clone

CAT#: SC126554

CAMK2D (untagged)-Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 2


  "NM_172128" in other vectors (6)

Reconstitution Protocol

USD 732.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal antibody to CaMKII delta (calcium/calmodulin-dependent protein kinase II delta)
    • 100 ul

USD 625.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CAMK2D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CAMK2D
Synonyms CAMKD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_172128, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCGACCACAACCTGCACCAGGTTCACGGACGAGTATCAGCTTTTCGAGGAGCTTGGAAAGGGGG
CATTCTCAGTGGTGAGAAGATGTATGAAAATTCCTACTGGACAAGAATATGCTGCCAAAATTATCAACAC
CAAAAAGCTTTCTGCTAGGGATCATCAGAAACTAGAAAGAGAAGCTAGAATCTGCCGTCTTTTGAAGCAC
CCTAATATTGTGCGACTTCATGATAGCATATCAGAAGAGGGCTTTCACTACTTGGTGTTTGATTTAGTTA
CTGGAGGTGAACTGTTTGAAGACATAGTGGCAAGAGAATACTACAGTGAAGCTGATGCCAGTCATTGTAT
ACAGCAGATTCTAGAAAGTGTTAATCATTGTCACCTAAATGGCATAGTTCACAGGGACCTGAAGCCTGAG
AATTTGCTTTTAGCTAGCAAATCCAAGGGAGCAGCTGTGAAATTGGCAGACTTTGGCTTAGCCATAGAAG
TTCAAGGGGACCAGCAGGCGTGGTTTGGTTTTGCTGGCACACCTGGATATCTTTCTCCAGAAGTTTTACG
TAAAGATCCTTATGGAAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTATATTCTACTTGTGGGG
TATCCACCCTTCTGGGATGAAGACCAACACAGACTCTATCAGCAGATCAAGGCTGGAGCTTATGATTTTC
CATCACCAGAATGGGACACGGTGACTCCTGAAGCCAAAGACCTCATCAATAAAATGCTTACTATCAACCC
TGCCAAACGCATCACAGCCTCAGAGGCACTGAAGCACCCATGGATCTGTCAACGTTCTACTGTTGCTTCC
ATGATGCACAGACAGGAGACTGTAGACTGCTTGAAGAAATTTAATGCTAGAAGAAAACTAAAGGGTGCCA
TCTTGACAACTATGCTGGCTACAAGGAATTTCTCAGCAGCCAAGAGTTTGTTGAAGAAACCAGATGGAGT
AAAGGAGTCAACTGAGAGTTCAAATACAACAATTGAGGATGAAGATGTGAAAGCACGAAAGCAAGAGATT
ATCAAAGTCACTGAACAACTGATCGAAGCTATCAACAATGGGGACTTTGAAGCCTACACAAAAATCTGTG
ACCCAGGCCTTACTGCTTTTGAACCTGAAGCTTTGGGTAATTTAGTGGAAGGGATGGATTTTCACCGATT
CTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAATCCACACTATTATTCTAAACCCTCATGTACAT
CTGGTAGGGGATGATGCCGCCTGCATAGCATATATTAGGCTCACACAGTACATGGATGGCAGTGGAATGC
CAAAGACAATGCAGTCAGAAGAGACTCGTGTGTGGCACCGCCGGGATGGAAAGTGGCAGAATGTTCATTT
TCATCGCTCGGGGTCACCAACAGTACCCATCAACTAA


Restriction Sites SgfI-MluI     
ACCN NM_172128
Insert Size 3460 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172128.2, NP_742126.1
RefSeq Size 5776 bp
RefSeq ORF 1437 bp
Locus ID 817
UniProt ID Q13557
Cytogenetics 4q26
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Calcium signaling pathway, ErbB signaling pathway, Glioma, GnRH signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Wnt signaling pathway
Gene Summary The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, compared to variant 3. The resulting isoform (2) has a shorter C-terminus, compared to isoform 3. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extend of this RefSeq trasncript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.