HMGA1 (NM_145901) Human Untagged Clone

CAT#: SC124566

HMGA1 (untagged)-Human high mobility group AT-hook 1 (HMGA1), transcript variant 3


  "NM_145901" in other vectors (4)

Reconstitution Protocol

USD 150.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-HMGA1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HMGA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMGA1
Synonyms HMG-R; HMGA1A; HMGIY
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_145901, the custom clone sequence may differ by one or more nucleotides


ATGAGTGAGTCGAGCTCGAAGTCCAGCCAGCCCTTGGCCTCCAAGCAGGAAAAGGACGGCACTGAGAAGC
GGGGCCGGGGCAGGCCGCGCAAGCAGCCTCCGGTGAGTCCCGGGACAGCGCTGGTAGGGAGTCAGAAGGA
GCCCAGCGAAGTGCCAACACCTAAGAGACCTCGGGGCCGACCAAAGGGAAGCAAAAACAAGGGTGCTGCC
AAGACCCGGAAAACCACCACAACTCCAGGAAGGAAACCAAGGGGCAGACCCAAAAAACTGGAGAAGGAGG
AAGAGGAGGGCATCTCGCAGGAGTCCTCGGAGGAGGAGCAGTGA


>OriGene 5' read for NM_145901 unedited
NNGGGCCATATCCCCCGCCCGTTGCCGCTTTGGGCGGTAGGCGTGTACGGTGGGAGGTCT
ATATAAGCAGTTCTCATTTAGGTGACACTATAGGAGACAGGCTACTTGCTCTTTTTGCAG
CGGCCGCGAATTCGGCACGAGGCTCCGGTGAGTCCCGGGACAGCGCTGGTAGGGAGTCAG
AAGGAGCCCAGCGAAGTGCCAACACCTAAGAGACCTCGGGGCTCGACCAAAGGGAAGCAA
AAACAAGGGTGCTGGGGGACCCGGAAAACCACCACAACTCCAGGAAGGAAACCAAGGGGC
AGACCCAAAAAACTGGAGAAGGAGGAAGAGGAGGGCATCTCGCAGGAGTCCTCGGAGGAG
GAGCAGTGACCCATGCGTGCCGCCTGCTCCTCACTGGAGGAGCAGCTTCCTTCTGGGACT
GGACAGCTTTGCTCCGCTCCCACCGCCCCCGCCCCTTCCCCAGGCCCACCATCACCACCG
CCTCTGGCCGCCACCCCCATCTTCCACCTGTGCCCTCACCACCACACTACACAGCACACC
AGCCGCTGCAGGGCTCCCATGGGCTGAGTGGGGAGCAGTTTTCCCCTGGCCTCAGTTCCC
AGCTCCCCCCGCCCACCCACGCATACACACATGCCCTCCTGGACAAGGCTAACATCCCAC
TTAGCCGCACCCTGCACCTGCTGCGTCCCCACTCCCTTGGTGGTGGGGACATTGCTCTCT
GGGCTTTTGGTTTGGGGGCGCCCTCTCTGCTCCTTCACTGGTCCCTCTGGCTTCCATAGG
GGGCCTGGGGAGGGTTCCCCTGGCCTTAAAGGGGCCCAAGCCCCACTCATCCTGGCACGC
CTACTCCACTGCCTGGCACAGCAGGTGGGCCATGGAAGGGG
Restriction Sites NotI-NotI     
ACCN NM_145901
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145901.1, NP_665908.1
RefSeq Size 1876 bp
RefSeq ORF 324 bp
Locus ID 3159
UniProt ID P17096
Cytogenetics 6p21.31
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - JAK/STAT signaling pathway, Transcription Factors
Gene Summary This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 3, 9, 10, 12, and 13 encode isoform (a, also called HMG-I). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.