LYRM7 (NM_181705) Human Untagged Clone

CAT#: SC124565

LYRM7 (untagged)-Human Lyrm7 homolog (mouse) (LYRM7)


  "NM_181705" in other vectors (5)

Reconstitution Protocol

USD 150.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LYRM7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYRM7
Synonyms C5orf31; MC3DN8; MZM1L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181705, the custom clone sequence may differ by one or more nucleotides


ATGGGACGGGCAGTCAAGGTTTTACAGCTCTTTAAAACACTGCACAGGACCAGACAACAAGTTTTTAAAA
ATGATGCCAGAGCATTAGAAGCAGCCAGAATAAAGATAAATGAAGAATTCAAAAATAATAAAAGTGAAAC
TTCTTCTAAGAAAATAGAAGAGCTAATGAAAATAGGTTCTGATGTTGAATTATTACTCAGAACATCTGTT
ATACAAGGTATTCACACAGACCACAATACACTGAAACTGGTCCCTAGGAAAGACCTTCTTGTAGAAAATG
TGCCATATTGTGATGCACCAACTCAGAAGCAATGA


>OriGene 5' read for NM_181705 unedited
GTAATTGTATACGACTACTATAGGCGGCCGACGAATTCGCACCAGCCGCGGTGAGGAGAG
CCTGGGACGGGCAGTCAAGGTTTTACAGCTCTTTAAAACACTGCACAGGACCAGACAACA
AGTTTTTAAAAATGATGCCAGAGCATTAGAAGCAGCCAGAATAAAGATAAATGAAGAATT
CAAAAATAATAAAAGTGAAACTTCTTCTAAGAAAATAGAAGAGAACTGGTCCCTATGAAA
GACCTTCTTGTAGAAAATGTGCCATATTGTGATGCACCAACTCAGAAGCAATGAGTTTTC
TAGAATACAACAAGTCTTTGTACTTTTTAACTTTAAAATCTACAACTCTGGCAAAAGTCC
TGGAAATGCAGACATTTTCCCTGAACTGGCATATTGAAAATGAATGAATTACAGAATAGC
TTCATATTTAAATTTCATGTTAAAAGGTCATTACTGAGAACTAAAGAACATAATTAAGTA
TTTCTAAAGGAAATTAGATAAGAAAACATTTCATTTTCATTGAAAATCAAATTTCATAAA
GCAAAGTAAATGCTTAGGGAGATATATTCAATCTTTGACCTTGATGAGTATTTGATCTTA
CCATAGCTATTTGAGAATGTGGAGCTTTTACAAATTGGTGAGTTTTCCTGCCATGTGAAA
TGCAATTATTACATTTAAATTGTTAGATTAAAATGATATTTAGTCCTGAAAAATATTAAA
TTGGCCAAAANAATCAGTGTATGCCAGCTCTCTCAGAAAGGGCCTTTGTTCTCTAAGCAC
TGNGATTATCTCTGTAGCTATATATAATTGCACAGTCNCTTTCTAGAGATAGAGAGTATC
TCTGAGGCTCTATGAAGACATTCTCTATCAGCTTTCTGAAATAGATGAATANATATTATA
GTCACCTAGGGTCACTATGGNATAAAGAATCCTANCTAAGAGGAANTAGTGGNCCTGATC
AAACTATTATATGGCCTAGTAGAATAAGCTGACTTAAACAAGTAGACCTATCGGGATGG
Restriction Sites NotI-NotI     
ACCN NM_181705
Insert Size 2850 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181705.1, NP_859056.1
RefSeq Size 2104 bp
RefSeq ORF 315 bp
Locus ID 90624
UniProt ID Q5U5X0
Cytogenetics 5q23.3-q31.1
Gene Summary Inner mitochondrial membrane complex III (CIII) is the main enzyme complex in the mitochondrial respiratory chain, and Rieske Fe-S protein (UQCRFS1) is the last catalytic subunit added to the complex. The protein encoded by this gene is a nuclear-encoded mitochondrial matrix protein that stabilizes UQCRFS1 and chaperones it to the CIII complex. Defects in this gene are a cause of mitochondrial complex III deficiency, nuclear type 8. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.