Rel B (RELB) (NM_006509) Human Untagged Clone

CAT#: SC122747

RELB (untagged)-Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Rel B
• Synonyms: I-REL; IMD53; IREL; REL-B
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006509, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCGGTCTGGGCCAGCCTCTGGGCCGTCCGTCCCCACTGGCCGGGCCATGCCGAGTCGCCGCGTCG
  CCAGACCGCCGGCTGCGCCGGAGCTGGGGGCCTTAGGGTCCCCCGACCTCTCCTCACTCTCGCTCGCCGT
  TTCCAGGAGCACAGATGAATTGGAGATCATCGACGAGTACATCAAGGAGAACGGCTTCGGCCTGGACGGG
  GGACAGCCGGGCCCGGGCGAGGGGCTGCCACGCCTGGTGTCTCGCGGGGCTGCGTCCCTGAGCACGGTCA
  CCCTGGGCCCTGTGGCGCCCCCAGCCACGCCGCCGCCTTGGGGCTGCCCCCTGGGCCGACTAGTGTCCCC
  AGCGCCGGGCCCGGGCCCGCAGCCGCACCTGGTCATCACGGAGCAGCCCAAGCAGCGCGGCATGCGCTTC
  CGCTACGAGTGCGAGGGCCGCTCGGCCGGCAGCATCCTTGGGGAGAGCAGCACCGAGGCCAGCAAGACGC
  TGCCCGCCATCGAGCTCCGGGATTGTGGAGGGCTGCGGGAGGTGGAGGTGACTGCCTGCCTGGTGTGGAA
  GGACTGGCCTCACCGAGTCCACCCCCACAGCCTCGTGGGGAAAGACTGCACCGACGGCATCTGCAGGGTG
  CGGCTCCGGCCTCACGTCAGCCCCCGGCACAGTTTTAACAACCTGGGCATCCAGTGTGTGAGGAAGAAGG
  AGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAA
  CCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAG
  ATGCGCCGGATGGATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
  GGATTTGCCGAATTAACAAGGAAAGCGGGCCGTGCACCGGTGGCGAGGAGCTCTACTTGCTCTGCGACAA
  GGTGCAGAAAGAGGACATATCAGTGGTGTTCAGCAGGGCCTCCTGGGAAGGTCGGGCTGACTTCTCCCAG
  GCCGACGTGCACCGCCAGATTGCCATTGTGTTCAAGACGCCGCCCTACGAGGACCTGGAGATTGTCGAGC
  CCGTGACAGTCAACGTCTTCCTGCAGCGGCTCACCGATGGGGTCTGCAGCGAGCCATTGCCTTTCACGTA
  CCTGCCTCGCGACCATGACAGCTACGGCGTGGACAAGAAGCGGAAACGGGGGATGCCCGACGTCCTTGGG
  GAGCTGAACAGCTCTGACCCCCATGGCATCGAGAGCAAACGGCGGAAGAAAAAGCCGGCCATCCTGGACC
  ACTTCCTGCCCAACCACGGCTCAGGCCCGTTCCTCCCGCCGTCAGCCCTGCTGCCAGACCCTGACTTCTT
  CTCTGGCACCGTGTCCCTGCCCGGCCTGGAGCCCCCTGGCGGGCCTGACCTCCTGGACGATGGCTTTGCC
  TACGACCCTACGGCCCCCACACTCTTCACCATGCTGGACCTGCTGCCCCCGGCACCGCCACACGCTAGCG
  CTGTTGTGTGCAGCGGAGGTGCCGGGGCCGTGGTTGGGGAGACCCCCGGCCCTGAACCACTGACACTGGA
  CTCGTACCAGGCCCCGGGCCCCGGGGATGGAGGCACCGCCAGCCTTGTGGGCAGCAACATGTTCCCCAAT
  CATTACCGCGAGGCGGCCTTTGGGGGCGGCCTCCTATCCCCGGGGCCTGAAGCCACGTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_006509
• Insert Size: 2248 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006509.2, NP_006500.2
• RefSeq Size: 2287 bp
• RefSeq ORF: 1740 bp
• Locus ID: 5971
• UniProt ID: Q01201
• Cytogenetics: 19q13.32
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: MAPK signaling pathway
• Gene Summary: NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. NF-kappa-B heterodimeric RelB-p50 and RelB-p52 complexes are transcriptional activators. RELB neither associates with DNA nor with RELA/p65 or REL. Stimulates promoter activity in the presence of NFKB2/p49. As a member of the NUPR1/RELB/IER3 survival pathway, may provide pancreatic ductal adenocarcinoma with remarkable resistance to cell stress, such as starvation or gemcitabine treatment. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer in a CRY1/CRY2 independent manner. Increased repression of the heterodimer is seen in the presence of NFKB2/p52. Is required for both T and B lymphocyte maturation and function (PubMed:26385063).[UniProtKB/Swiss-Prot Function]