Alcohol Dehydrogenase (ADH1A) (NM_000667) Human Untagged Clone

CAT#: SC119750

ADH1A (untagged)-Human alcohol dehydrogenase 1A (class I), alpha polypeptide (ADH1A)


  "NM_000667" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-ADH1A Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Alcohol Dehydrogenase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Alcohol Dehydrogenase
Synonyms ADH1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC119750 sequence for NM_000667 edited (data generated by NextGen Sequencing)
ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAA
CCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAG
ATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACC
CCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGG
GTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAA
TGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCT
CAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCAC
TTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAA
ATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGT
TATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGC
CTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATC
ATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAA
TGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGAT
GGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTG
TTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAA
AACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTT
GGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAG
TTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTT
GACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA

Clone variation with respect to NM_000667.3
Restriction Sites Please inquire     
ACCN NM_000667
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000667.2, NP_000658.1
RefSeq Size 1456 bp
RefSeq ORF 1128 bp
Locus ID 124
UniProt ID P07327
Cytogenetics 4q23
Domains ADH_zinc_N
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Fatty acid metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism, Tyrosine metabolism
Gene Summary This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.