TAF12 (NM_005644) Human Untagged Clone

CAT#: SC116608

TAF12 (untagged)-Human TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa (TAF12), transcript variant 2


  "NM_005644" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-TAF12 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TAF12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAF12
Synonyms TAF2J; TAFII20
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005644 edited
ATGAACCAGTTTGGCCCCTCAGCCCTAATCAACCTCTCCAATTTCTCATCCATAAAACCG
GAACCAGCCAGCACCCCTCCACAAGGCTCCATGGCCAATAGTACTGCAGTGGTAAAGATA
CCAGGCACTCCTGGGGCAGGAGGTCGTCTTAGCCCTGAAAACAATCAGGTATTGACCAAG
AAGAAATTACAGGACTTAGTAAGAGAAGTGGATCCTAATGAGCAGTTGGATGAAGATGTG
GAGGAGATGCTGCTGCAGATTGCTGATGATTTTATCGAGAGTGTGGTGACAGCAGCCTGT
CAGCTTGCGCGGCATCGCAAGTCTAGCACCCTGGAGGTGAAAGATGTCCAGCTGCATTTA
GAGCGCCAGTGGAACATGTGGATCCCAGGATTTGGCTCTGAAGAAATCCGACCCTACAAA
AAAGCTTGCACCACAGAAGCTCACAAACAGAGAATGGCATTGATCCGGAAAACAACCAAG
AAATAA
>OriGene 5' read for NM_005644 unedited
ATTTTGTATACGACTCCTATGGGCGGCCGCGAATTCGGCACGAGGTGCATATCATGGGGA
GATAGACGCTGCTGCCTTTAATTGGCCTTGGTCCTCACAGCTCCAAAAGAACAGGATCTC
GATAAGCTCTATGAGCTGAAGTCCAAAGCTCGGCAGATTATGAACCAGTTTGGCCCCTCA
GCCCTAATCAACCTCTCCAATTTCTCATCCATAAAACCGGAACCAGCCAGCACCCCTCCA
CAAGGCTCCATGGCCAATAGTACTGCAGTGGTAAAGATACCAGGCACTCCTGGGGCAGGA
GGTCGTCTTAGCCCTGAAAACAATCAGGTATTGACCAAGAAGAAATTACAGGACTTAGTA
AGAGAAGTGGATCCTAATGAGCAGTTGGATGAAGATGTGGAGGAGATGCTGCTGCAGATT
GCTGATGATTTTATCGAGAGTGTGGTGACAGCAGCCTGTCAGCTTGCGCGGCATCGCAAG
TCTAGCACCCTGGAGGTGAAAGATGTCCAGCTGCATTTAGAGCGCCAGTGGAACATGTGG
ATCCCAGGATTTGGCTCTGAAGAAATCCGACCCTACAAAAAAGCTTGCACCACAGAAGCT
CACAAACAGAGAATGGCATTGATCCGGAAAACAACCAAGAAATAACACACGGAAAGGTCA
GGGAATGGACAGCAATGTATTTGGAGATACTTGAGCTGAGAACTCAGCCATCTCATCCTT
GGATTNTNTTTTTTAATGCTTTACAGAGAAGCATATATTTTTTATTAACAGTGCAGCAAT
ATCTATTATGACTGGAGAGGATCTGCCAAAAGATAAAGCCTNCTACCCCCACTTNNCGGN
TCCTTTTCCCTGGCATCTCANAGAGGAGCCATGTATCTTCCAGAGAAGATTTTATTTGTG
GGT
Restriction Sites NotI-NotI     
ACCN NM_005644
Insert Size 2740 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005644.2, NP_005635.1
RefSeq Size 1113 bp
RefSeq ORF 486 bp
Locus ID 6883
UniProt ID Q16514
Cytogenetics 1p35.3
Domains TFIID_A
Protein Families Transcription Factors
Protein Pathways Basal transcription factors
Gene Summary Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.