Glycophorin C (GYPC) (NM_016815) Human Untagged Clone

CAT#: SC114128

GYPC (untagged)-Human glycophorin C (Gerbich blood group) (GYPC), transcript variant 2


  "NM_016815" in other vectors (6)

Reconstitution Protocol

USD 150.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-GYPC Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GYPC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GYPC
Synonyms CD236; CD236R; GE; GE:GPC:GPD:GYPD; GPC; GPD; GYPD; PAS-2; PAS-2'
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_016815, the custom clone sequence may differ by one or more nucleotides


ATGTGGTCGACGAGAAGCCCCAACAGCACGGCGTGGCCTCTCAGCCTCGAGCCTGATCCAGGGATGTCTG
GATGGCCGGATGGCAGAATGGAGACCTCCACCCCCACCATAATGGACATTGTCGTCATTGCAGGTGTGAT
TGCTGCTGTGGCCATCGTCCTAGTCTCCCTCCTCTTCGTCATGCTGCGCTACATGTACCGGCACAAGGGC
ACGTACCACACCAATGAGGCCAAGGGCACGGAGTTTGCTGAGAGTGCAGATGCAGCCCTGCAGGGAGACC
CTGCCCTCCAAGATGCTGGTGATAGCAGCAGAAAGGAGTACTTTATTTGA


>OriGene 5' read for NM_016815 unedited
GTCAGCATTTGTATACGACTCACTATAGGCGGCNCGCGAATTCGCACGAGGGAGCCCGGG
AGCGCGACCCTCCCCCGGCCCGGCCTGGCCCGGCCTGGCCAGTCCCCGCGGTCTCTGCCC
GGGCTGACGCCCAGGAATGTGGTCGACGAGAAGCCCCAACAGCACGGCGTGGCCTCTCAG
CCTCGTTACATGGGAATAGGACTCTCGGCTCAAGGCGTCAACATGAACAGACTTCCTGGT
TGGGACAAACATTCCTATGGTTACCATGGTGATGATGGGCATTCGTTCTGCTCCTCGGGG
ACTGGCCAGCCCTATGGTCCCACATTCACCACAGGAGACGTGATCGGCTGCTGTGTCAAC
CTCATCAATGGCACCTGCTTCTACACCAAGAATGGCCACAGCCTTGGCCAACCTCTACCC
CACCGTAGGCCTGCAGACACCTGGGGAGATTGTGGACGCCAACTTTGGGCAGCAGCCCTT
CCTGTTTGACATTGAGGACTACATGCGGGAGTGGCGTGCCAAGGTCCAGGGCACGGTCCA
CTGCTTCCCCATCAGTGCCCGGCTTGGCGAGTGGCAGGCAGTGCTGCAGAACATGGTTTC
ATCTTACCTCGTGCATCATGGGTATTGTGCCACAGCCACGGCTTTTGCTCGAATGACTGA
AACCCCGATTCAGGAAGAACAGGCGTCCATAAAGAACCAGACAAAGATCCAGAANCTGGT
GCTGGANGGGCCGTGTGGGCGAGGCCATCGAGACCACCCAGCGCTTCTACCCAGGGCTGC
TGGAGCACAACCCAACCTNCTCTTATGCTCAAGTGCCGCAGTTTGTGGAGATGGTGATGG
GACNGACAGTGAGTTCCCAAGTTGAGCTNCCGAAGCCCCAGTCCAGGAAGCTACCTGGCT
CCCCAGNCTCAGTCCCGACTGGCCCAGTATT
Restriction Sites NotI-NotI     
ACCN NM_016815
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016815.2, NP_058131.1
RefSeq Size 1019 bp
RefSeq ORF 330 bp
Locus ID 2995
UniProt ID P04921
Cytogenetics 2q14.3
Protein Families Druggable Genome, Transmembrane
Gene Summary Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) lacks and in-frame exon in the central coding region, compared to variant 1. The encoded isoform 2 is shorter than isoform 1. This isoform (2) specifies the Yus phenotype.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.