PILRA (NM_178272) Human Untagged Clone

CAT#: SC110417

PILRA (untagged)-Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 2


  "NM_178272" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PILRA Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PILRA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PILRA
Synonyms FDF03
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_178272, the custom clone sequence may differ by one or more nucleotides


ATGGGTCGGCCCCTGCTGCTGCCCCTACTGCCCTTGCTGCTGCCGCCAGCATTTCTGCAGCCTAGTGGCT
CCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGTGG
CTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCACAGCTCCCGACGTGAGAATATCC
TGGAGACGGGGCCACTTCCACAGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGATTATG
TGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGAAGAGCGGCTTCCTCAGGATCTCCAACCTGCAGAA
GCAGGACCAGTCTGTGTATTTCTGCCGAGTTGAGCTGGACACACGGAGCTCAGGGAGGCAGCAGTGGCAG
TCCATCGAGGGGACCAAACTCTCCATCACCCAGGGTCAGCAGCGGACTAAAGCCACAACCCCAGCCAGGG
AACCCTTCCAAAACACAGAGGAGCCATATGAGAATATCAGGAATGAAGGACAAAATACAGATCCCAAGCT
AAATCCCAAGGATGACGGCATCGTCTATGCTTCCCTTGCCCTCTCCAGCTCCACCTCACCCAGAGCACCT
CCCAGCCACCGTCCCCTCAAGAGCCCCCAGAACGAGACCCTGTACTCTGTCTTAAAGGCCTAA


>OriGene 5' read for NM_178272 unedited
GCACGAGGGCTGGGTCCCTGAATCACCGACTGGAGGAGAGTTACCTACAAGAGCCTTCAT
CCAGGAGCATCCACACTGCAATGATATAGGAATGAGGCGGCCCCTCCACAGGGCCCCTCT
CCTGCCTGGACGGCTCTGCTGGTCTCCCCGTCCCCTGGAGAAGAACAAGGCCATGGGTCG
GCCCCTGCTGCTGCCCCTACTGCCCCTGCTGCTGCCGCCAGCATTTCTGCAGCCTAGTGG
CTCCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGC
CTCCATGGGTGGCTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCAC
AGCTCCCGACGTGAGAATATCCTGGAGACGGGGCCACTTCCACGGGCAGTCCTTCTACAG
CACAAGGCCGCCTTCCATTCACAAGGATTATGTGAACCGGCTCTTTCTGAACTGGACAGA
GGGTCAGAAGAGCGGTTTCCTCAGGATCTCCAACCTGCAGAAGCAGGACCAGTCTGTGTA
TTTCTGCCGAGTTGAGCTGGACACACGGAGCTCAGGGAGGCAGCAGTGGCAGTCCATCGA
GGGGACCAAACTCTCCATCACCCAGGGTCAGCAGCGGACTAAAGCCACAACCCCAGCCAG
GGAACCCTTCCA
Restriction Sites NotI-NotI     
ACCN NM_178272
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178272.1, NP_840056.1
RefSeq Size 1104 bp
RefSeq ORF 693 bp
Locus ID 29992
UniProt ID Q9UKJ1
Cytogenetics 7q22.1
Protein Families Druggable Genome, Transmembrane
Gene Summary Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks a coding exon, compared to variant 1, resulting in a protein (isoform 2) with a missing internal segment, compared to isoform 1. Isoform 2 is thought to be a soluble protein, since it lacks the transmembrane domain found in isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.