PPP2R3A (NM_181897) Human Untagged Clone

CAT#: SC107434

PPP2R3A (untagged)-Human protein phosphatase 2, regulatory subunit B'', alpha (PPP2R3A), transcript variant 2


  "NM_181897" in other vectors (6)

Reconstitution Protocol

USD 493.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PPP2R3A Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PPP2R3A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP2R3A
Synonyms PPP2R3; PR72; PR130
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC107434 sequence for NM_181897 edited (data generated by NextGen Sequencing)
ATGATGATCAAGGAAACATCTCTACGAAGGGACCCGGATTTAAGGGGAGAGCTAGCTTTC
CTGGCAAGGGGCTGTGATTTTGTTCTCCCTTCACGGTTTAAGAAGCGGCTGAAGTCATTT
CAGCAGACACAGATTCAAAATAAACCAGAAAAGAAACCTGGAACACCACTCCCACCTCCA
GCCACCTCTCCAAGTAGTCCCCGACCTCTCTCCCCGGTTCCCCATGTGAATAATGTTGTG
AATGCGCCATTGTCCATAAACATTCCACGGTTCTACTTTCCTGAAGGACTCCCAGATACC
TGTAGTAATCATGAACAAACTCTAAGCAGAATTGAAACTGCTTTCATGGATATTGAAGAA
CAGAAAGCAGACATTTATGAAATGGGGAAAATTGCAAAGGTCTGTGGCTGTCCTCTCTAT
TGGAAAGCCCCCATGTTCAGGGCTGCAGGGGGAGAGAAGACAGGATTTGTGACAGCACAG
TCATTCATTGCCATGTGGAGAAAGTTGCTGAATAACCATCATGATGATGCCTCTAAATTC
ATCTGTCTTCTAGCAAAGCCCAACTGCAGCTCTCTAGAACAGGAGGATTTCATCCCTCTA
CTTCAGGATGTGGTGGATACCCACCCTGGTCTCACGTTCCTGAAAGATGCTCCAGAATTC
CACTCCCGCTACATCACCACGGTTATTCAGAGAATATTCTACACAGTCAACAGATCTTGG
AGTGGAAAAATTACTTCGACAGAGATAAGAAAAAGCAACTTTTTGCAAACCCTAGCACTT
TTGGAAGAAGAGGAAGATATAAACCAAATTACAGATTACTTCTCCTATGAACATTTCTAT
GTTATTTATTGTAAATTCTGGGAACTAGATACTGATCACGACCTCTACATCAGCCAGGCC
GATCTGTCTCGATACAATGACCAGGCTTCATCAAGCAGGATTATTGAAAGGATATTCTCT
GGTGCAGTAACAAGGGGAAAAACAATACAGAAAGAGGGAAGAATGAGCTATGCAGATTTT
GTTTGGTTTTTGATCTCTGAAGAAGACAAAAGGAATCCTACCAGCATTGAGTATTGGTTC
CGCTGCATGGATGTGGATGGAGACGGTGTACTCTCCATGTATGAGCTGGAGTACTTCTAT
GAGGAGCAGTGTGAACGGATGGAAGCCATGGGAATTGAGCCCTTGCCATTCCATGATTTA
CTGTGCCAGATGCTTGACCTAGTGAAGCCAGCTGTTGATGGCAAAATAACTCTAAGAGAT
CTGAAGAGGTGCAGAATGGCTCACATCTTCTATGACACTTTCTTTAATCTGGAGAAATAC
TTAGACCATGAACAGAGAGATCCCTTTGCGGTCCAGAAGGATGTTGAGAACGATGGGCCT
GAGCCCTCAGACTGGGACCGGTTTGCCGCTGAGGAGTATGAGACGCTTGTTGCAGAGGAA
TCTGCCCAAGCACAATTCCAGGAAGGCTTTGAAGATTATGAAACAGATGAACCTGCCTCT
CCCTCTGAATTTGGAAACAAAAGCAATAAAATATTAAGTGCAAGCCTTCCAGAGAAATGT
GGAAAGCTTCAATCAGTGGATGAAGAATAG

Clone variation with respect to NM_181897.2
Restriction Sites NotI-NotI     
ACCN NM_181897
Insert Size 3870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181897.1, NP_871626.1
RefSeq Size 4664 bp
RefSeq ORF 1590 bp
Locus ID 5523
UniProt ID Q06190
Cytogenetics 3q22.2-q22.3
Protein Families Druggable Genome, Phosphatase
Gene Summary This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (2), also known as isoform alpha or isoform PR72, contains a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.