Fhl1 (NM_001271199) Rat Untagged Clone

CAT#: RN216232

Fhl1 (untagged) - Rat four and a half LIM domains 1 (Fhl1), transcript variant 3


  "NM_001271199" in other vectors (1)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fhl1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Fhl1
Synonyms SLIM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216232 representing NM_001271199
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGAGAAGTTCGACTGTCACTACTGCAGGGACCCCTTGCAGGGGAAGAAGTATGTGCAGAAGGATG
GCCGTCACTGCTGCCTGAAGTGCTTTGACAAGTTCTGCGCCAACACCTGCGTGGAATGCCGCAAGCCCAT
AAGCGCTGATGCTAAGGAGGTGCACTATAAGAATCGCTACTGGCACGACACCTGCTTCCGCTGTGCCAAG
TGCCTTCACCCCTTGGCCAGTGAGACCTTTGTGTCCAAGGATGGCAAGATCCTGTGCAACAAGTGCGCCA
CTCGGGAGGACTCCCCCAGGTGCAAAGGGTGCTTCAAGGCCATTGTGGCAGGAGACCAGAATGTGGAGTA
CAAGGGCACCATCTGGCATAAAGACTGCTTCACCTGCAGCAACTGCAAGCAAGTCATTGGGACCGGAAGC
TTCTTCCCGAAAGGGGAGGACTTCTACTGTGTGACTTGCCATGAGACCAAGTTTGCCAAGCATTGCGTGA
AATGCAACAAGGCCATCACATCTGGAGGAATCACTTACCAGGATCAGCCCTGGCATGCCGAGTGCTTTGT
GTGTGTTACCTGCTCTAAGAAGCTGGCGGGGCAGCGTTTCACCGCTGTGGAGGACCAGTATTACTGCGTG
GATTGCTACAAGAACTTTGTGGCCAAGAAGTGTGCTGGATGCAAGAACCCCATCACTGGGTTTGGTAAAG
GCTCCAGTGTGGTGGCCTATGAAGGACAATCCTGGCACGACTACTGCTTCCACTGCAAAAAATGCTCCGT
GAATCTGGCCAACAAGCGCTTTGTCTTTCATAATGAGCAGGTGTATTGTCCTGACTGTGCCAAAAAGCTG
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271199
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271199.1, NP_001258128.1
RefSeq Size 2325 bp
RefSeq ORF 843 bp
Locus ID 25177
UniProt ID Q9WUH4
Cytogenetics Xq37
Gene Summary contains a zinc binding domain; expressed in skeletal muscle [RGD, Feb 2006]
Transcript Variant: This variant (3) contains 2 alternate exons at the 5' end compared to variant 1, which results in translation initiation from an in-frame downstream AUG and an isoform (3) with a shorter N-terminus compared to isoform 1. Variants 3 and 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.