Fxyd5 (NM_001270688) Rat Untagged Clone
CAT#: RN215965
Fxyd5 (untagged) - Rat FXYD domain-containing ion transport regulator 5 (Fxyd5), transcript variant 2
"NM_001270688" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd5 |
Synonyms | RIC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215965 representing NM_001270688
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACCGCCCAGTCAGCTGTGTCTCCTCACCATTGTCGCCCTGATTCTGCCTAGTGAAGGGCAGACAC CAGAAAAACCCAGATCCAGTTTTACAGCGCACCAGAGTTCTGTGACTACTCATGTCCCAGTTCCAGATCA AACCAGCCCAGGAGTCCAGACCACTCCTCCCATCTGGACCAGTGAAGCTGGCGAAGCCACAGGAAGCCAG ACAGCAGCCAAAACCAAGACCCAGCAACTGACCGAAATGGCCACTGCGAATCCAGTGACAGATCCAGGGC CACTTACAAGCAGCGAGAAAGGTACCCCGGCACTCTCCAGGATCAAATCTCCCAGCCCACCCAAAGGTTA CATGCCTCCATCCTACATTGAGAATCCACTGGATCCCAATGAGAACAGCCCCTTCTACTACGACAATACC ACCCTCCGGAAACGGGGGCTGCTGGTGGCGGCAGTGCTGTTCATTACTGGAATTATCATCCTCACTAGTG GGAAGTGTAGACAGTTCTCTCAGTTATGCCTGAATCGCCACAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270688 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270688.1, NP_001257617.1 |
RefSeq Size | 826 bp |
RefSeq ORF | 537 bp |
Locus ID | 60338 |
UniProt ID | P59647 |
Cytogenetics | 1q21 |
Gene Summary | This reference sequence was derived from multiple replicate ESTs and validated by similar mouse cDNA sequence and human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Three transcript variants encoding the same protein have been found for this gene. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215965 | Fxyd5 (myc-DDK-tagged) - Rat FXYD domain-containing ion transport regulator 5 (Fxyd5), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review