Uqcc3 (NM_001168661) Rat Untagged Clone
CAT#: RN215778
LOC690344 (untagged) - Rat similar to Protein UNQ655/PRO1286 homolog precursor (LOC690344)
"NM_001168661" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Uqcc3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215778 representing NM_001168661
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCAGCTCGTAAAGCACTGGCTGTAGTTGCAGTGCTAGGCGCGGGAGGTGGCGTGGGTTCTATTC TGTTTGCCTTAGTGACCCCAGGAGAACTACAGAAGCAGTTAATGCTGCAGGAGATGCCGGAAAGGGACTC GCGGCGCAGGGACGAAGCAGTCAGGACCAAGGAACTGGTGATGGCTACCCTGAAGGACGCCGCAGCCACG AAGGAGAACGTGGCCTGGAGGAGGAACTGGACAGTTAGAGGCGACGGCAGGTCAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168661 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001168661.1, NP_001162132.1 |
RefSeq Size | 690 bp |
RefSeq ORF | 270 bp |
Locus ID | 690344 |
UniProt ID | P0CD94 |
Cytogenetics | 1q43 |
Gene Summary | Required for the assembly of the ubiquinol-cytochrome c reductase complex (mitochondrial respiratory chain complex III or cytochrome b-c1 complex), mediating cytochrome b recruitment and probably stabilization within the complex. Thereby, plays an important role in ATP production by mitochondria. Cardiolipin-binding protein, it may also control the cardiolipin composition of mitochondria membranes and their morphology.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215778 | LOC690344 (myc-DDK-tagged) - Rat similar to Protein UNQ655/PRO1286 homolog precursor (LOC690344) |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review