Mxra8 (NM_001007002) Rat Untagged Clone

CAT#: RN215685

Mxra8 (untagged ORF) - Rat matrix-remodelling associated 8 (Mxra8), (10 ug)


  "NM_001007002" in other vectors (3)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mxra8"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mxra8
Synonyms 1200013a08rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215685 representing NM_001007002
Red=Cloning site Blue=ORF Orange=Stop codon

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCC
C

ATGGAACTGCTATCCCGTGTCTTGTTGTGGAAACTGGTGCTTCTTCAGAGTTCTGCAGTCCTGTCCTCAG
GGTCTCCAGGGACCGCAGCAGCCAGCAGCTCTGTGGTGTCTGAGTCTGCGGTGAGCTGGGCAGCCGGAAC
TCAGGCGGTGCTACGCTGCCAGAGCCCGCGCATGGTGTGGACCCAAGACCGGCTGCACGATCGCCAGCGC
GTGGTCCACTGGGACCTCAGCGGTGGCCCAGGTAGCCAAGGGCGCCGACTTGTGGATATGTACTCGGCCG
GGGAACAGCGCGTGTACCAGCCGCGCGATCGCGACCGCCTCCTGCTGTCGCCTTCTGCCTTCCACGACGG
CAACTTCTCGCTGCTCATCCGCGCTGTGGAGAGAGGCGACGAAGGGGTGTACACCTGCAATCTGCACCAT
CACTACTGCCACCTCTACGAGAGCCTGGCTGTGCGCCTCGAGGTCACTGACGATCCCCTATTAAGTCGCG
CATACTGGGACGGAGAGAAGGAAGTGTTGGTGGTGGCCCTCGGCGCACCGGCTCTGATGACTTGCGTGAA
CCGTGAGCACTTGTGGACTGACCGCCACTTAGAGGAGGCGCAGCAGGTGGTCCATTGGGACCGACAGCTA
CCTGGCGTGCCACATGACCGCGCTGACCGATTGCTTGACCTGTACGCATCCGGCGAGCGCCGAGCCTACG
GGCCACCCTTCCTGCGTGATCGCGTGTCGGTGAACACCAACGCTTTTGCACGCGGGGACTTCTCCCTACG
CATAGATGACCTGGAGCCGGCTGATGAGGGCATCTATTCCTGCCACCTGCACCACCACTACTGTGGTCTC
CATGAGCGCCGAGTCTTCCACCTACGGGTCACGGAGCCTGTTTTTGAGCCACCAGCTCGCGCTTCTCCTG
GCAATGGGTCTGGTCACAACAGTGTTCCTAGCCCAGATCCCACCATGGCCCGTGGCCACAGCATCATCAA
CGTCATTGTCCCAGAGGACCACACACATTTCTTCCAGCAATTGGGCTATGTGCTGGCCACTCTACTGCTT
TTCATCTTGCTGCTCATCACTGTAGTCCTGGCGACACGCCACCGTCACAGTGGAGGATGCAAGACCTCAG
ACAGGAAAGCTGGGAAATCAAAGGGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites AscI-MluI     
ACCN NM_001007002
Insert Size 1149 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007002.1, NP_001007003.1
RefSeq Size 2296 bp
RefSeq ORF 1149 bp
Locus ID 313770
UniProt ID Q5XI43
Cytogenetics 5q36
Gene Summary Transmembrane protein which can modulate activity of various signaling pathways, probably via binding to integrin ITGAV:ITGB3. Mediates heterophilic cell-cell interactions in vitro. Inhibits osteoclastogenesis downstream of TNFSF11/RANKL and CSF1, where it may function by attenuating signaling via integrin ITGB3 and MAP kinase p38. Plays a role in cartilage formation where it promotes proliferation and maturation of growth plate chondrocytes. Stimulates formation of primary cilia in chondrocytes. Enhances expression of genes involved in the hedgehog signaling pathway in chondrocytes, including the hedgehog signaling molecule IHH; may also promote signaling via the PTHLH/PTHrP pathway. Plays a role in angiogenesis where it suppresses migration of endothelial cells and also promotes their apoptosis. Inhibits VEGF-induced activation of AKT and p38 MAP kinase in endothelial cells. Also inhibits VTN (vitronectin)-mediated integrin ITGAV:ITGB3 signaling and activation of PTK2/FAK. May play a role in the maturation and maintenance of the blood-brain barrier.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.