Zc3h12a (NM_001077671) Rat Untagged Clone

CAT#: RN215071

Zc3h12a (untagged ORF) - Rat zinc finger CCCH type containing 12A (Zc3h12a), (10 ug)


  "NM_001077671" in other vectors (3)

Reconstitution Protocol

USD 611.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zc3h12a"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Zc3h12a
Synonyms MCPIP-1; Reg1; RGD1306776
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215071 representing NM_001077671
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGACCCCTGTGGGAAGAAACTTGTCCAAGAAATCAGCCCCACCATGAGTCTGTGGGGGCTTGAGG
ACAGACACAGCTGCCAAGGTCAACCTCAGCCAGACCAGGATCCTGTGGCTAAAGAGGCCTCTGCTTCCGA
GCTGCAGATGAAGGTGGACTTTTTCCGTAAACTGGGATACTCGTCTTCTGAGATCCACAGTGCCCTGCAG
AAGCTGGGAGTCCAAGCAGACACCAACACGGTGCTGGGGGAGCTGGTGAAGCACGGTTCAGCTACTGAAC
GAGAGTGCCAGGCCTCCACAGACCCCTGCCCCCAGCCCCCTCTGGTGCCCCGGGGTGGAAGCACCCCCAA
GCCTTCCACTGTAGAACCCTCACTCCCAGAGGAGGACAAAGAGAGCAGTGACCTGAGACCAGTGGTCATC
GACGGAAGCAACGTGGCCATGAGCCATGGGAACAAAGAAGTCTTCTCCTGCCGGGGCATTTTGCTGGCTG
TGAACTGGTTTCTGGAGCGGGGCCATACAGACATCACCGTGTTTGTGCCATCGTGGAGGAAGGAACAGCC
TCGGCCAGATGTGCCTATCACAGACCAGCACATTCTGCGGGAACTAGAGAAAAAGAAGATCCTGGTGTTC
ACGCCATCCAGGCGGGTCGGTGGCAAGCGTGTAGTGTGCTACGATGACCGATTCATTGTGAAGCTGGCCT
ATGAATCCGACGGAGTGGTGGTGTCCAATGACACATACCGGGACCTCCAAGGCGAGAGGCAGGAGTGGAA
GCGCTTCATCGAGGAGAGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTCATGCCCCCTGACGACCCT
TTAGGACGCCACGGGCCTAGCCTGGACAACTTCCTGCGTAAGAAACCACTGCCTTCTGAACACAGGAAGC
AGCCATGTCCCTATGGGAGAAAATGTACTTATGGAATCAAGTGCCGGTTCTTCCACCCGGAGCGGCCAAG
CCGCCCCCAGCGCTCTGTGGCTGATGAGCTCCGGGCCAACGCCCTTCTCTCGCCCCCCAGGACTCCAGTC
AAGGACAAAAGTAGCCAGAGGCCTTCCCCTGCCTCTCAGCCCAACTCCATGTCCCTAGAGGCTGAGCCAG
GCAGCCCAGATGGGAAAAAACTGGGTACCAGATCCTCCCCAGGCCCCCACCAAGAAGGCTCAACACAGAC
CTGTGCTCCGGCTGGCAGGAGCCTCCCTGTTAGTGGGGGCAGCTTTGGGCCCACAGAGTGGCTCCCACAC
ACCCTGGACTCGCTCCCATACACCTCCCAGGAGTGCCTTGATTCAGGCATTGGCTCCCTGGAGAGCCAGA
TGTCAGAATTGTGGGGGTTGCGAGGAGGTAGCCCTGGGGAGTCGGGCCCCACTCGGGGTCCTTATACTGG
TTACCAAACCTATGGATCCAAGCTCCCTGCAGCGCCTGCCTTTTCTCCCTTTAGACAAGCCATCGGTACT
GGCCATTTCAGTGTCCCCACCGACTATGTGCCCCCGCCACCCACCTACCCAGCCAGAGAGTACTGGTCTG
AGCCATACCCATTGCCCCCACCCACTCCAGTCCTTCAGGAGCCCCAGAGACCCAGACCCAGGGCCAGTGG
GGACCCCTGGGGCAGGGTGAGCGACCTGGCCAAAGAAAGGGCTGGTGTGTATACCAAGCTGTGTGGTGTC
TTTCCCCCACACCTGGTAGAAGCTGTGATGGGTCGTTTCCCACAGCTCCTGGACCCCCAGCAGCTGGCCG
CTGAGATCCTTTCTTACAAGTCCCAGCACCTCAGTGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001077671
Insert Size 1791 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001077671.1, NP_001071139.1
RefSeq Size 2567 bp
RefSeq ORF 1791 bp
Locus ID 313587
UniProt ID A0JPN4
Cytogenetics 5q36
Gene Summary Endoribonuclease involved in various biological functions such as cellular inflammatory response and immune homeostasis, glial differentiation of neuroprogenitor cells, cell death of cardiomyocytes, adipogenesis and angiogenesis. Functions as an endoribonuclease involved in mRNA decay. Modulates the inflammatory response by promoting the degradation of a set of translationally active cytokine-induced inflammation-related mRNAs, such as IL6 and IL12B, during the early phase of inflammation. Prevents aberrant T-cell-mediated immune reaction by degradation of multiple mRNAs controlling T-cell activation, such as those encoding cytokines (IL6 and IL2), cell surface receptors (ICOS, TNFRSF4 and TNFR2) and transcription factor (REL). Inhibits cooperatively with ZC3H12A the differentiation of helper T cells Th17 in lungs. They repress target mRNA encoding the Th17 cell-promoting factors IL6, ICOS, REL, IRF4, NFKBID and NFKBIZ. The cooperation requires RNA-binding by RC3H1 and the nuclease activity of ZC3H12A (By similarity). Self regulates by destabilizing its own mRNA. Cleaves mRNA harboring a stem-loop (SL), often located in their 3' UTRs, during the early phase of inflammation in a helicase UPF1-dependent manner (By similarity). Plays a role in the inhibition of microRNAs (miRNAs) biogenesis (By similarity). Cleaves the terminal loop of a set of precursor miRNAs (pre-miRNAs) important for the regulation of the inflammatory response leading to their degradation, and thus preventing the biosynthesis of mature miRNAs (By similarity). Plays also a role in promoting angiogenesis in response to inflammatory cytokines by inhibiting the production of antiangiogenic microRNAs via its anti-dicer RNase activity (By similarity). Affects the overall ubiquitination of cellular proteins. Positively regulates deubiquitinase activity promoting the cleavage at 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains on TNF receptor-associated factors (TRAFs), preventing JNK and NF-kappa-B signaling pathway activation, and hence negatively regulating macrophage-mediated inflammatory response and immune homeostasis (By similarity). Induces also deubiquitination of the transcription factor HIF1A, probably leading to its stabilization and nuclear import, thereby positively regulating the expression of proangiogenic HIF1A-targeted genes. Involved in a TANK-dependent negative feedback response to attenuate NF-kappaB activation through the deubiquitination of IKBKG or TRAF6 in response to interleukin-1-beta (IL1B) stimulation or upon DNA damage (By similarity). Prevents stress granules (SGs) formation and promotes macrophage apoptosis under stress conditions, including arsenite-induced oxidative stress, heat shock, and energy deprivation. Plays a role in the regulation of macrophage polarization; promotes IL4-induced polarization of macrophages M1 into anti-inflammatory M2 state. May also act as a transcription factor that regulates the expression of multiple genes involved in inflammatory response, angiogenesis, adipogenesis and apoptosis (By similarity). Functions as a positive regulator of glial differentiation of neuroprogenitor cells through an amyloid precursor protein (APP)-dependent signaling pathway (By similarity). Attenuates septic myocardial contractile dysfunction in response to lipopolysaccharide (LPS) by reducing I-kappa-B-kinase (IKK)-mediated NF-kappa-B activation, and hence myocardial proinflammatory cytokine production (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.