Neurog1 (NM_019207) Rat Untagged Clone

CAT#: RN203614

Neurog1 (untagged ORF) - Rat neurogenin 1 (Neurog1), (10 ug)


  "NM_019207" in other vectors (3)

Reconstitution Protocol

USD 330.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Neurog1 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Neurog1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Neurog1
Synonyms Neurod3; Ngn1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203614 representing NM_019207
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGCCCCTTTGGAGACCTGTCTCTCTGACCTCGACTGCGCCAGCAGCAACAGCGGGAGCGACCTGT
CCAGTTTCCTCACCGACGAGGAGGACTGTGCCAGGCTCCAGCCCCTAGCTTCCACCTCAGGGCTGTCCGT
GCCAGCCCGCAGGAGCGCGCCCACCCTCTCCGGGGCATCGAACGTTCCCGGTGGCCAGGACGAAGAGCAG
GAGCGGCGGCGACGGCGAGGTCGCGCGCGGGTGCGGTCCGAGGCGCTGCTGCACTCGCTGCGGAGGAGCC
GTCGCGTCAAGGCCAACGATCGCGAGCGCAACCGTATGCATAACCTCAACGCTGCGCTGGACGCTCTGCG
CAGCGTGCTGCCCTCGTTCCCCGACGACACCAAGCTCACCAAGATTGAGACGCTGCGCTTCGCCTACAAC
TACATCTGGGCCCTGGCTGAGACACTGCGCCTGGCAGATCAAGGGCTCCCGGGGGGCGGTGCCCGGGAGC
GCCTCCTGCCTCCGCAGTGTGTCCCCTGCCTGCCCGGTCCCCCGAGCCCGGCCAGCGATACAGAGTCCTG
GGGCTCCGGGGCCGCTGCCTCCCCCTGCGCTACTGTGGCGTCACCACTCTCTGACCCCAGTAGTCCCTCG
GCTTCAGAAGACTTCACCTATGGCCCGGGTGGTCCCCTTTTCTCCTTTCCTGGCCTGCCCAAAGACCTCC
TCCATACGACACCCTGCTTCATCCCGTACCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019207
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019207.1, NP_062080.1
RefSeq Size 1527 bp
RefSeq ORF 735 bp
Locus ID 29410
UniProt ID P70595
Cytogenetics 17p14
Gene Summary may play a role in neuronal differentiation [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.