Parp16 (NM_001014093) Rat Untagged Clone

CAT#: RN203347

Parp16 (untagged ORF) - Rat poly (ADP-ribose) polymerase family, member 16 (Parp16), (10 ug)


  "NM_001014093" in other vectors (3)

Reconstitution Protocol

USD 330.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Parp16"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Parp16
Synonyms ARTD15; LRRGT00109; RGD1306243
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203347 representing NM_001014093
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCTCTCCAACAGGGCGGCAGCCAGGGAGTCGGTGAGCCGCGACGTGCTGGCCGCGGACCTCCGCT
GCAGCCTCTTCGCCTCAGCGCTGCAGAGCTACAAGCGGGACTCGGTGCTGCGGCCCTTCCCCGCCTCCTA
CGCCCGCCACGACTGTAAGGACTTCGAGGCCCTGCTTGCGGACACTGGCAGGTTACCTAACTTGAAGGAA
CTTCTGCAGTCCTCCAGGGACACAGACAAACAGACCTGGGACCTGGTGAGCTGGATTCTATCCTCCAAGA
TCCTGACAATCCACAGTGCAGAGAAGGCCGAGTTTGAAAAGATCCAGCAGCTGACCGGTGCACCTCACAC
ACCTGTCCCCATCCCAGATTTCCTTTTTGAAATTGAGTACTTTGACCCGGCCAATGCCAGATTCTATGAG
ACCAAAGGAGGGCGAGACCTGATCTATGCCTTCCATGGCAGCCGCCTAGAGAACTTCCATTCCATCATTC
ACAACGGCCTGCATTGTCACCTGAACAAGACTTCTCTGTTTGGAGAGGGGACCTACCTCACAAGTGACTT
GAGCCTGGCCCTCATTTATAGTCCTCACGGCCGTGGGTGGCAGCATAGCCTCCTTGGCCAGACCCTTAGC
TGTGTAGCTGTGTGTGAGGTCATCGACCATCCAGATGTCAAGTGCCAAACCAAGAAGAAGGATTCCAAGG
AAATCGACCGCAGCAGAGCTCGAATCAAGCACAGCGAAGGGGGAGATGTCCCCCCTAAGTACTTTGTAGT
CACTAACAACCAGCTTCTGCGGGTGAAGTACCTACTGGTGTATTCCCAGAAGCAGCCCAAGAGGGCCTCG
AGCCAGCTTTCCTGGCTGTGCAGCCATTGGTTCATGGTCGCGATGTCCCTCTATCTGCTGCTGCTGCTCA
TCGTCAGTGTCACCAACTCCTCTGCCTTCCAGCACTTCTGGAATCGCCTGAAGAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001014093
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014093.1, NP_001014115.1
RefSeq Size 2336 bp
RefSeq ORF 969 bp
Locus ID 315760
UniProt ID Q5U2Q4
Cytogenetics 8q24
Gene Summary Intracellular mono-ADP-ribosyltransferase that may play a role in different processes through the mono-ADP-ribosylation of proteins involved in those processes. May play a role in the unfolded protein response (UPR), by ADP-ribosylating and activating EIF2AK3 and ERN1, two important UPR effectors. May also mediate mono-ADP-ribosylation of karyopherin KPNB1 a nuclear import factor. May not modify proteins on arginine or cysteine residues compared to other mono-ADP-ribosyltransferases.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.