Cdk10 (NM_001109937) Rat Untagged Clone

CAT#: RN200073

Cdk10 (untagged ORF) - Rat cyclin-dependent kinase 10 (Cdk10), transcript variant 2, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Cdk10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200073 representing NM_001109937
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACAAAGAGAAAGATGGCATCCCCATCAGCAGCCTGCGTGAAATCACACTGCTCCTGCGTCTCCGCC
  ATCCCAACATTGTGGAGCTGAAGGAGGTGGTTGTTGGCAACCACCTGGAGAGCATCTTCCTGGTCATGGG
  TTACTGTGAACAAGATCTGGCCAGCCTATTGGAAAATATGCCAACGCCCTTCTCGGAGGCCCAGGTTAAG
  TGCATCCTGCTGCAAGTGCTTCGAGGCCTTCAGTACCTGCACCGGAGCTTCATCATCCACAGGGACCTGA
  AGGTGTCCAACTTGCTCATGACAGATAAGGGCTGTGTGAAGACAGCCGATTTCGGCCTGGCTCGGGCCTA
  TGGTGTTCCAGTAAAGCCAATGACTCCCAAGGTTGTTACCCTCTGGTACCGAGCCCCAGAGCTGCTGCTT
  GGAACTACTACCCAGACTACCAGCATCGACATGTGGGCTGTTGGCTGCATCCTGGCAGAGCTGCTGGCCC
  ATAAGCCCCTTCTCCCTGGCACTTCCGAGATCCACCAGATCGACTTGATCGTACAGCTGTTGGGGACACC
  GAGTGAGAATATCTGGCCTGGTTTCTCCAAGCTGCCCCTGGCCGGCCAGTACAGCCTGAGGAAACAGCCC
  TACAACAACCTCAAGCACAAGTTCCCATGGCTCTCAGAGGCCGGACTGCGCCTGCTCAACTTCCTCTTCA
  TGTATGACCCTAAGAAAAGGGCAACAGCAGGAGACTGCCTGGAGAGTTCCTACTTCAAGGAGAAGCCCCT
  ACCCTGCGAGCCGGAGCTCATGCCTACCTTCCCCCACCACCGTAACAAGCGTGCTGCCCCAGCTGCCACT
  GAGGGGCAGAGCAAACGATGCCGGCCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001109937
• Insert Size: 870 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_001109937.1, NP_001103407.1
• RefSeq Size: 1629 bp
• RefSeq ORF: 870 bp
• Locus ID: 361434
• UniProt ID: Q4KM47
• Cytogenetics: 19q12
• Gene Summary: The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. The human ortholog has been shown to play a role in cellular proliferation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses a different donor splice site at the first exon compared to transcript variant 1, resulting in translation initiation from an in-frame, downstream AUG, and a shorter isoform (2) compared to isoform 1.