Stk11 (NM_001301853) Mouse Untagged Clone

CAT#: MC227561

Stk11 (untagged) - Mouse serine/threonine kinase 11 (Stk11), transcript variant 2


  "NM_001301853" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Stk11"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Stk11
Synonyms AA408040; Lkb1; Par-4; R75140
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227561 representing NM_001301853
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTGGCGGACCCCGAGCCGTTGGGCCTTTTCTCCGAGGGCGAGCTGATGTCGGTGGGCATGGACA
CCTTCATCCACCGCATCGACTCCACCGAGGTAATCTACCAGCCGCGCCGCAAACGCGCCAAGCTCATCGG
CAAGTACCTGATGGGGGACCTGCTCGGGGAGGGCTCGTACGGCAAGGTGAAGGAGGTGCTGGACTCCGAG
ACCTTATGCCGCAGGGCGGTCAAGATCCTCAAGAAGAAAAAGCTGCGCAGGATCCCCAATGGAGAGGCCA
ACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCT
GTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTG
GACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCC
TGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAA
TGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGC
CGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTGCCAATGGACTGGACACCTTTTCAGGTT
TCAAGGTGGACATCTGGTCAGCTGGGGTCACACTTTACAACATCACCACGGGCCTGTACCCATTTGAGGG
GGACAATATCTACAAGCTCTTTGAGAACATTGGGAGAGGAGACTTCACCATCCCTTGTGACTGCGGCCCA
CCACTCTCTGACCTACTCCGAGGGATGTTGGAGTATGAGCCGGCCAAGAGGTTCTCCATCCGACAGATTA
GGCAGCACAGCTGGTTCCGGAAGAAACACCCTCTGGCTGAGGCGCTCGTACCTATCCCACCAAGCCCAGA
CACTAAGGACCGCTGGCGCAGTATGACTGTAGTGCCCTACCTGGAGGACCTGCATGGCCGTGCGGAGGAG
GAGGAGGAGGAAGACTTGTTTGACATTGAGGACGGCATTATCTACACCCAGGACTTCACAGTGCCTGGTG
TCGAGGAGGCGGCCGAGGCAGGGCTTAGCGAGGATGCATGCGACACATGCATGTGGAAGAGCCAGGGCGC
AGGCCTTCCTGGAGAGGAGCCCGAGGAGGGGTTTGGGGCTTTAGTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301853
Insert Size 1239 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301853.1, NP_001288782.1
RefSeq Size 2054 bp
RefSeq ORF 1239 bp
Locus ID 20869
UniProt ID Q9WTK7
Cytogenetics 10 C1
Gene Summary This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (S, see PMID:18774945) has a distinct C-terminus and is shorter than isoform L. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.