Acta1 (NM_001272041) Mouse Untagged Clone

CAT#: MC227367

Acta1 (untagged) - Mouse actin, alpha 1, skeletal muscle (Acta1), transcript variant 1


  "NM_001272041" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Acta1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Acta1
Synonyms AA959943; Acta-2; Acts; Actsk-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227367 representing NM_001272041
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCGACGAAGACGAGACCACCGCTCTTGTGTGTGACAACGGCTCTGGCCTGGTGAAAGCTGGCTTTG
CCGGGGATGATGCCCCCAGGGCTGTGTTCCCATCCATCGTGGGCCGACCCCGTCACCAGGGTGTCATGGT
AGGTATGGGTCAGAAGGACTCCTACGTGGGTGATGAGGCCCAGAGCAAGCGAGGTATCCTGACCCTGAAG
TACCCCATTGAACATGGCATCATCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACA
ATGAGCTGCGTGTGGCCCCTGAGGAGCACCCGACTCTGCTCACCGAGGCCCCCCTGAACCCCAAAGCTAA
CCGGGAGAAGATGACTCAAATCATGTTTGAGACCTTCAACGTGCCTGCCATGTATGTGGCTATCCAGGCG
GTGCTGTCCCTCTATGCTTCCGGCCGTACCACCGGCATCGTGTTGGATTCTGGGGACGGTGTCACCCACA
ACGTGCCCATCTATGAGGGCTATGCCCTGCCACACGCCATCATGCGTCTGGACCTGGCCGGTCGCGACCT
CACTGACTACCTGATGAAAATCCTCACTGAGCGTGGCTATTCCTTCGTGACCACAGCTGAACGTGAGATT
GTGCGCGACATCAAAGAGAAGCTGTGCTATGTGGCCCTGGACTTCGAGAATGAGATGGCCACCGCTGCCT
CTTCCTCCTCCCTGGAGAAGAGCTATGAGCTGCCCGACGGGCAGGTCATCACCATCGGCAATGAGCGTTT
CCGTTGCCCGGAGACGCTCTTCCAGCCTTCCTTTATCGGTATGGAGTCTGCGGGGATCCATGAGACCACC
TACAACAGCATCATGAAGTGCGACATCGACATCAGGAAGGACCTGTATGCCAACAACGTCATGTCAGGGG
GCACCACCATGTACCCTGGTATCGCTGACCGCATGCAGAAGGAGATCACAGCTCTGGCTCCCAGCACCAT
GAAGATCAAGATCATCGCCCCCCCTGAGCGCAAGTACTCAGTGTGGATCGGTGGCTCCATCCTGGCCTCG
CTGTCCACCTTCCAGCAGATGTGGATCACCAAGCAGGAGTACGACGAGGCTGGCCCCTCCATTGTGCACC
GCAAATGCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001272041
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272041.1, NP_001258970.1
RefSeq Size 1571 bp
RefSeq ORF 1134 bp
Locus ID 11459
UniProt ID P68134
Cytogenetics 8 72.26 cM
Gene Summary Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.