Elp5 (NM_001253700) Mouse Untagged Clone

CAT#: MC226043

Elp5 (untagged) - Mouse elongator acetyltransferase complex subunit 5 (Elp5), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Elp5
• Synonyms: Derp6; Rai12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226043 representing NM_001253700
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCAACAGCCGGTGATAACTCCCTAGTAGAGCAGGTGCGTGTCCTGGGCCTCCTACATGAAGAGCTTC
  ATGGCCCAGGCTCCATGGGAGCACTGAACACCCTTGCTCACACAGAGGTGACTCTGAGTGGTAAAGTGGA
  CCAGACCTCAGCCTCCATCCTCTGTCGAAGGCCCCAACAACGTGCAACTTACCAGACTTGGTGGTTCTCC
  GTTCTTCCTGACTTCAGCCTGACTCTCCATGAAGGGCTTCCCCTCCGTTCTGAGCTACACCCGGATCATC
  ACACAACCCAGGTGGATCCCACTGCTCATTTGACCTTTAACCTTCACTTATCCAAGAAAGAAAGAGAAGC
  CAGAGACAGCCTCACTCTGCCTTTCCAGTTCAGCTCTGAAAAACAGAAAGCTCTGCTGCATCCGGTACCC
  AGCCGGACCACTGGCCACATCTTCTATGAGCCAGATGCTTTTGATGATGTGGACCCAGAAGACCCAGATG
  ATGACCTAGATATTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253700
• Insert Size: 507 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253700.1, NP_001240629.1
• RefSeq Size: 969 bp
• RefSeq ORF: 507 bp
• Locus ID: 54351
• Cytogenetics: 11 B3
• Gene Summary: Acts as subunit of the RNA polymerase II elongator complex, which is a histone acetyltransferase component of the RNA polymerase II (Pol II) holoenzyme and is involved in transcriptional elongation. Elongator may play a role in chromatin remodeling and is involved in acetylation of histones H3 and probably H4. May be involved in TP53-mediated transcriptional regulation. Involved in cell migration.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct and shorter N-terminus, compared to isoform 1.