Mpdu1 (NM_001301711) Mouse Untagged Clone
CAT#: MC225778
Mpdu1 (untagged) - Mouse mannose-P-dolichol utilization defect 1 (Mpdu1), transcript variant 3
"NM_001301711" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mpdu1 |
Synonyms | LEC3; LEC35; SL; SL15; Supl; Supl15h |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225778 representing NM_001301711
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCACTACAGAGGAGAGACCGTGAAAGGAGTCGCTTTCCTTGCCTGCTATGCCATGGTCCTGCTGGCGC TGCTCTCCCCGCTCACGCCTCTGGCTGTAGTCACTCTGCTCCAGGCCTCCAATGTACCTGCCGTGGTGGT GGGGAAGTTGCTTCAGGCAGCCACTAACTACCGCAACGGACACACAGGCCAGCTTTCAGCCATTACAGTG TTTATGCTGTTTGGGGGCTCCTTGGCCCGAATCTTCACTTCTGTTCAGGAAACTGGAGACCCCCTCATGG CTGGAGTCTTTGTGGTCTCTTCTCTCTGCAATGGCCTCATTGCTGCCCAGGTCCTCTTCTACTGGAACGC AAAGGCTCCCCACAAACAGAAAAAGGAGCAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301711 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001301711.1, NP_001288640.1 |
RefSeq Size | 1363 bp |
RefSeq ORF | 384 bp |
Locus ID | 24070 |
Cytogenetics | 11 42.86 cM |
Gene Summary | This gene encodes a member of the PQ-loop superfamily. A similar gene in human encodes a protein that is required for monosaccharide-P-dolichol-dependent glycosyltransferase reactions, and disruption of this gene is the cause of congenital disorder of glycosylation (CDG) type 1F, a disease linked to defects in protein N-glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (3) uses an alternate splice site and uses an in-frame downstream start codon, compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227989 | Mpdu1 (myc-DDK-tagged) - Mouse mannose-P-dolichol utilization defect 1 (Mpdu1), transcript variant 3 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review