Fkbp1a (NM_001302077) Mouse Untagged Clone
CAT#: MC225666
Fkbp1a (untagged) - Mouse FK506 binding protein 1a (Fkbp1a), transcript variant 2
"NM_001302077" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fkbp1a |
Synonyms | Fkb; Fkbp; Fkbp1; FKBP12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225666 representing NM_001302077
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGTGCAGGTGGAGACCATCTCTCCTGGAGACGGGCGCACCTTCCCAAAGCGCGGCCAGACCTGCG TGGTGCACTACACGGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCTCGGGACAGAAACAAGCCTTT TAAGTTTACACTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAGGAAGGGGTAGCCCAGATGAGTGTGGGT CAGAGAGCCAAACTGATAATCTCCTCAGACTATGCCTATGGAGCCACCGGGCACCCAGGCATCATCCCAC CACATGCCACTCTTGTTTTTGATGTGGAGCTTCTAAAACTGGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302077 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302077.1, NP_001289006.1 |
RefSeq Size | 1663 bp |
RefSeq ORF | 327 bp |
Locus ID | 14225 |
UniProt ID | P26883 |
Cytogenetics | 2 G3 |
Gene Summary | This gene is a member of the immunophilin family. The encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, and is associated with immunoregulation, protein folding, receptor signaling, protein trafficking and T-cell activation. It may modulate the calcium release activity of the ryanodine receptor Ryr1. It also interacts with the type I TGF-beta receptor. Disruption of this gene in mouse causes severe ventricular defects. Pseudogenes of this gene have been defined on chromosomes 4, 10, 14, and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227877 | Fkbp1a (myc-DDK-tagged) - Mouse FK506 binding protein 1a (Fkbp1a), transcript variant 2 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review