Rpain (NM_001252414) Mouse Untagged Clone
CAT#: MC225656
Rpain (untagged) - Mouse RPA interacting protein (Rpain), transcript variant 4
"NM_001252414" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rpain |
Synonyms | 2400006N03Rik; Rip |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225656 representing NM_001252414
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGAGTCCTCGGGGTCTCCGCACCGCTTGTTGTACAAGCAGGTGGGCTCGCCCCACTGGAAAGAAA CTTTCAGGCAGGGATGTCTGGAGAGAATGAGAAACAGCAGGCACAGGCTCCTGAACAAATATCGCCAGGC TGCAGGTAGCACGCCGGGGACAGCCTCAGACAGACTTCTTGTGCAAGAAGTAATGGAGGAAGAGTGGGCT TCTTTGCAGTCTGTGGAGAATTGTCCGGAGGCCTTGCTTCAGTTGGAATTGCCACTGGACCTAGCTGTGC TGCAGGACATCGAGCAGGAGCTGTGTAATGAAGACTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252414 |
Insert Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001252414.1, NP_001239343.1 |
RefSeq Size | 896 bp |
RefSeq ORF | 321 bp |
Locus ID | 69723 |
UniProt ID | Q9CWY9 |
Cytogenetics | 11 B4 |
Gene Summary | Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Sumoylation mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks several exons in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (4) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227867 | Rpain (myc-DDK-tagged) - Mouse RPA interacting protein (Rpain), transcript variant 4 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review