Gabra2 (NM_008066) Mouse Untagged Clone

CAT#: MC215935

Gabra2 (untagged) - Mouse gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 (Gabra2), (10ug)


  "NM_008066" in other vectors (4)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gabra2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gabra2
Synonyms C630048P16Rik; Gabra-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215935 representing NM_008066
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGACAAAATTGAGCACATGCAATGTATGGTCTCTGCTGCTTGTTCTTCTGGTGTGGGACCCAGTCA
GGTTGGTGCTGGCTAACATCCAAGAAGATGAGGCTAAAAATAACATCACCATCTTTACAAGAATTCTAGA
CAGACTTCTGGATGGTTATGATAATCGGCTTAGACCAGGACTGGGAGACAGTATTACTGAAGTCTTCACT
AACATTTACGTGACCAGTTTTGGCCCTGTCTCAGATACAGATATGGAGTATACAATAGATGTTTTCTTTC
GGCAAAAATGGAAAGATGAGCGTTTAAAATTTAAAGGTCCTATGAATATCCTTCGACTTAACAATTTAAT
GGCCAGCAAAATCTGGACTCCTGATACCTTCTTTCACAATGGGAAAAAGTCAGTGGCCCATAACATGACA
ATGCCAAACAAGCTGCTTCGAATCCAGGATGATGGAACATTGCTATATACCATGAGGCTTACAGTCCAAG
CCGAATGTCCCATGCACCTGGAGGATTTCCCGATGGATGCTCATTCATGCCCACTGAAATTTGGAAGCTA
CGCTTACACAACCTCAGAAGTCACATATATTTGGACTTACAATGCTTCTGACTCCGTTCAGGTTGCTCCC
GATGGCTCCAGGTTAAATCAGTATGATTTGCTGGGCCAGTCAATTGGGAAGGAAACAATTAAATCCAGTA
CAGGTGAATATACTGTAATGACAGCTCATTTCCACTTGAAAAGAAAAATTGGGTATTTTGTGATTCAGAC
CTATCTGCCTTGCATCATGACTGTCATTCTCTCCCAAGTGTCATTCTGGCTGAACAGAGAATCGGTGCCA
GCAAGAACTGTGTTTGGAGTAACAACTGTTCTAACAATGACAACCTTGAGCATCAGTGCTCGAAATTCCC
TCCCGAAAGTGGCTTATGCCACTGCCATGGACTGGTTTATAGCTGTTTGTTATGCGTTTGTGTTCTCTGC
CCTAATTGAATTTGCAACCGTGAATTACTTCACAAAAAGAGGATGGGCTTGGGACGGGAAGAGTGTAGTC
AATGACAAGAAAAAAGAGAAAGGCTCCGTCATGATACAGAACAACGCCTATGCGGTAGCTGTTGCCAACT
ATGCCCCGAATCTTTCCAAAGATCCTGTCCTCTCTACCATTTCCAAAAGTGCAACGACGCCAGAACCGAA
CAAGAAGCCAGAGAACAAGCCAGCTGAAGCCAAGAAAACCTTCAACAGTGTCAGCAAAATCGACAGGATG
TCTAGAATAGTGTTCCCAGTTCTGTTTGGTACTTTTAATTTAGTTTATTGGGCTACCTATTTAAACAGGG
AGCCTGTATTAGGGGTCAGTCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008066
Insert Size 1356 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008066.3, NP_032092.1
RefSeq Size 2392 bp
RefSeq ORF 1356 bp
Locus ID 14395
UniProt ID P26048
Cytogenetics 5 37.59 cM
Gene Summary Ligand-gated chloride channel which is a component of the heteropentameric receptor for GABA, the major inhibitory neurotransmitter in the brain (PubMed:27129275). Plays an important role in the formation of functional inhibitory GABAergic synapses in addition to mediating synaptic inhibition as a GABA-gated ion channel (PubMed:27129275). The gamma2 subunit is necessary but not sufficient for a rapid formation of active synaptic contacts and the synaptogenic effect of this subunit is influenced by the type of alpha and beta subunits present in the receptor pentamer (PubMed:27129275). The alpha2/beta2/gamma2 receptor exhibits synaptogenic activity whereas the alpha2/beta3/gamma2 receptor shows very little or no synaptogenic activity (PubMed:27129275).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.