H3c4 (NM_178204) Mouse Untagged Clone
CAT#: MC214361
Hist1h3d (untagged) - Mouse histone cluster 1, H3d (Hist1h3d), (10ug)
"NM_178204" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | H3c4 |
Synonyms | H3-b; H3c2; H3c3; H3c6; H3c7; H3c13; H3c14; H3c15; Hist1h; Hist1h3d |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214361 representing NM_178204
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCGTACTAAGCAGACCGCTCGCAAGTCCACCGGCGGCAAGGCCCCGCGCAAGCAGCTGGCCACCA AGGCCGCCCGCAAGAGCGCCCCGGCCACCGGCGGCGTGAAGAAGCCTCACCGCTACCGTCCCGGCACCGT GGCGCTGCGCGAGATCCGGCGCTACCAGAAGTCGACCGAGCTGCTGATCCGCAAGCTGCCGTTCCAGCGC CTGGTGCGCGAGATCGCGCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCGGCCGTCATGGCTCTGC AGGAGGCGAGCGAGGCCTACCTCGTGGGTCTGTTTGAGGACACCAACCTGTGTGCCATCCACGCCAAGCG TGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTCGCATTCGTGGGGAGAGGGCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_178204 |
Insert Size | 411 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_178204.2, NP_835511.1 |
RefSeq Size | 504 bp |
RefSeq ORF | 411 bp |
Locus ID | 319149 |
UniProt ID | P84228 |
Cytogenetics | 13 A3.1 |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217346 | Hist1h3d (tGFP-tagged) - Mouse histone cluster 1 H3d (Hist1h3d), (10ug) |
USD 350.00 |
|
MR217346 | Hist1h3d (Myc-DDK-tagged) - Mouse histone cluster 1, H3d (Hist1h3d) |
USD 150.00 |
|
MR217346L3 | Lenti ORF clone of Hist1h3d (Myc-DDK-tagged) - Mouse histone cluster 1, H3d (Hist1h3d) |
USD 450.00 |
|
MR217346L4 | Lenti ORF clone of Hist1h3d (mGFP-tagged) - Mouse histone cluster 1, H3d (Hist1h3d) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review