Tirap (NM_001177846) Mouse Untagged Clone

CAT#: MC212300

Tirap (untagged) - Mouse toll-interleukin 1 receptor (TIR) domain-containing adaptor protein (Tirap), transcript variant 3, (10ug)


  "NM_001177846" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tirap"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tirap
Synonyms AA407980; C130027E04Rik; Mal; Tlr4ap; Wyatt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212300 representing NM_001177846
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTAGTTTGGAGGCCTGCACTATGGCTTCATCCTCCTCCGTCCCAGCCTCCTCCACTCCGTCCAAGA
AGCCTCGAGACAAGATAGCTGACTGGTTCAGGCAGGCTCTGTTGAAGAAGCCCAAGAAGATGCCGATCTC
CCAGGAAAGCCACCTCTATGATGGTTCACAGACAGCCACACAGGATGGTCTCTCACCCTCGAGCTGCAGC
TCACCCCCGAGTCACAGTTCACCGGAGAGCCGTAGCTCACCCTCGAGCTGCAGTTCAGGAATGTCACCTA
CCTCGCCACCAACACACGTGGACAGCAGCAGCAGCAGCAGTGGCCGCTGGAGCAAAGACTACGATGTCTG
CGTGTGCCACAGTGAGGAGGACTTGGAGGCGGCCCAGGAGCTGGTCTCCTACTTGGAGGGTAGCCAGGCC
AGTCTACGCTGCTTCCTGCAGCTTCGGGATGCAGCCCCGGGTGGCGCCATTGTTTCGGAGCTATGCCAGG
CACTGAGTCGTAGTCACTGCCGTGTGCTGCTCATCACTCCAGGCTTCCTTCGGGACCCCTGGTGCAAGTA
CCAGATGCTGCAGGCCCTGACGGAGGCCCCGGCGTCGGAGGGTTGCACCATACCCCTGCTGTCCGGCCTG
TCCAGAGCCGCCTATCCGCCGGAACTCCGATTCATGTACTATGTGGATGGCAGAGGCAAGGACGGAGGCT
TTTACCAAGTCAAGGAGGCTGTTATACACTATCTGGAGACACTAAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177846
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177846.1, NP_001171317.1
RefSeq Size 4731 bp
RefSeq ORF 750 bp
Locus ID 117149
Cytogenetics 9 A4
Gene Summary Adapter involved in the TLR2 and TLR4 signaling pathways in the innate immune response. Acts via IRAK2 and TRAF-6, leading to the activation of NF-kappa-B, MAPK1, MAPK3 and JNK, and resulting in cytokine secretion and the inflammatory response (By similarity). Positively regulates the production of TNF-alpha and interleukin-6 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.