Mrpl43 (NM_053164) Mouse Untagged Clone
CAT#: MC212006
Mrpl43 (untagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein, (10ug)
"NM_053164" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mrpl43 |
Synonyms | 4930442D21Rik; bMRP; bMRP36a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212006 representing NM_053164
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGGTCGCGGGACTTCGAGCCGCTTTCTGACCAGCGTCCTCCATAATGGGCTAGGGCGTTACGTGC AGCAGCTGCAGCGCCTCAGCCTCAGCCTCAGCCGGGATGCGCCCTCGTCCCGCGGCGCCAGGGAGTTCGT GGAACGCGAGGTGACCGACTTCGCCCGACGGAACCCAGGAGTCGTAGTATACGTGAACCCGCGCCCGTGC GCCATGCCACGAATAGTGGCCGAATACCTTAATGGGGCTGTGCGCGAGGAAAACGTCAACAGCAAGTCGG TGGAGGAGATCAAGTCGTTGGTGCAGAAGCTGGCAGACCAGTCCGGCTTGGATGTGATCCGCATCCGCAA GCCCTTCCACACGGACAACCCGAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAACGGACTGCCCTC CACGGGCTGCGGCCCAGAGAACTCCGGGATTCTGCTCCAGCTTCGATGCAAGCACAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_053164 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_053164.3, NP_444394.1 |
RefSeq Size | 1213 bp |
RefSeq ORF | 480 bp |
Locus ID | 94067 |
Cytogenetics | 19 C3 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201223 | Mrpl43 (tGFP-tagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein |
USD 350.00 |
|
MR201223 | Mrpl43 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein |
USD 150.00 |
|
MR201223L3 | Lenti ORF clone of Mrpl43 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein |
USD 450.00 |
|
MR201223L4 | Lenti ORF clone of Mrpl43 (mGFP-tagged) - Mouse mitochondrial ribosomal protein L43 (Mrpl43), nuclear gene encoding mitochondrial protein |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review