Brwd1 (NM_176928) Mouse Untagged Clone
CAT#: MC211993
Brwd1 (untagged) - Mouse bromodomain and WD repeat domain containing 1 (Brwd1), transcript variant 3, (10ug)
"NM_176928" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Brwd1 |
Synonyms | 5330419I02Rik; D530019K20Rik; G1-403-16; repro5; Wdr9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211993 representing NM_176928
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGAGCCTTCGCCGGCCCGACGTCCGGTGCCTCTCATCGAGTCGGAGCTGTACTTTCTCATCGCCC GCTACCTCTCAGCTGGCCCGTGTCGCCGAGCGGCGCAGGTGCTGGTGCAGGAGCTGGAGCAGTACCAGCT GTTGCCGAAGAGGTTGGACTGGGAGGGCAACGAGCACAACAGGAGCTACGAGGAATTGGTCTTGTCCAAT AAACATGTGGCTCCTGACCACCTACTACAGATATGCCAGCGCATCGGTCCGATGCTGGATAAGGAGGTCC CGCCCAGTATCTCAAGAGTCACTTCTTTGCTTGGTGCAGGAAGGCAGTCTTTGCTACGAACAGCAAAAGG TACCTTAATTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_176928 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_176928.1, NP_795902.1 |
RefSeq Size | 2284 bp |
RefSeq ORF | 363 bp |
Locus ID | 93871 |
Cytogenetics | 16 C4 |
Gene Summary | May be a transcriptional activator. May be involved in chromatin remodeling. Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 3' UTR and CDS compared to variant 1. The resulting isoform (C) is much shorter and has a unique C-terminus compared to isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217419 | Brwd1 (tGFP-tagged) - Mouse bromodomain and WD repeat domain containing 1 (Brwd1) transcript variant 3, (10ug) |
USD 365.00 |
|
MR217419 | Brwd1 (Myc-DDK-tagged) - Mouse bromodomain and WD repeat domain containing 1 (Brwd1), transcript variant 3 |
USD 165.00 |
|
MR217419L3 | Lenti ORF clone of Brwd1 (Myc-DDK-tagged) - Mouse bromodomain and WD repeat domain containing 1 (Brwd1), transcript variant 3 |
USD 465.00 |
|
MR217419L4 | Lenti ORF clone of Brwd1 (mGFP-tagged) - Mouse bromodomain and WD repeat domain containing 1 (Brwd1), transcript variant 3 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review