Slurp2 (NM_001081961) Mouse Untagged Clone
CAT#: MC210937
2300005B03Rik (untagged) - Mouse RIKEN cDNA 2300005B03 gene (2300005B03Rik), (10ug)
"NM_001081961" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Slurp2 |
Synonyms | 2300005B03Rik; SLURP-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210937 representing NM_001081961
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCTTCCCTTCTGGTTCCTTCTGGCCGTGGTCTTGAGCATGGAGCTAGCTGTAACACAGGGCCTGC AATGCCACCTGTGCAAGGGATTTGGAGGATGCTCTCGCCCGTCTAGCTGCCCATGGAGCTCCACCCACTG TGTCATCATTGCCACCCGTTCTCCCATCAGCTTTACAGATCTGCCTCTGGTGACGAAGATGTGCTACAGT GGCTGTCCTGATGTCTCCAGCTTGGGCTTAGGTCCTCATGTATCCATCGCCTGCTGCCAGTCCAATCTCT GCAACAGGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081961 |
Insert Size | 294 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081961.1, NP_001075430.1 |
RefSeq Size | 464 bp |
RefSeq ORF | 294 bp |
Locus ID | 69462 |
UniProt ID | P0DP59 |
Cytogenetics | 15 D3 |
Gene Summary | Binds and may modulate the functional properties of nicotinic and muscarinic acetylcholine receptors. May regulate keratinocytes proliferation, differentiation and apoptosis. In vitro moderately inhibits ACh-evoked currents of alpha-3:beta-2-containing nAChRs, strongly these of alpha-4:beta-2-containing nAChRs, modulates alpha-7-containing nAChRs, and inhibits nicotine-induced signaling probably implicating alpha-3:beta-4-containing nAChRs. Proposed to act on alpha-3:beta-2 and alpha-7 nAChRs in an orthosteric, and on mAChRs, such as CHRM1 and CHRM3, in an allosteric manner.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218004 | 2300005B03Rik (tGFP-tagged) - Mouse RIKEN cDNA 2300005B03 gene (2300005B03Rik), (10ug) |
USD 350.00 |
|
MR218004 | 2300005B03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2300005B03 gene (2300005B03Rik) |
USD 150.00 |
|
MR218004L3 | Lenti ORF clone of 2300005B03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2300005B03 gene (2300005B03Rik) |
USD 450.00 |
|
MR218004L4 | Lenti ORF clone of 2300005B03Rik (mGFP-tagged) - Mouse RIKEN cDNA 2300005B03 gene (2300005B03Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review