Fndc4 (NM_022424) Mouse Untagged Clone

CAT#: MC210221

Fndc4 (untagged) - Mouse fibronectin type III domain containing 4 (Fndc4), (10ug)


  "NM_022424" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fndc4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fndc4
Synonyms 2810430J06Rik; 6330410H20Rik; AB030187; AI838506; AW487863; Fnmp1; FRCP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_022424, the custom clone sequence may differ by one or more nucleotides


ATGCCTCTGGCCCCTCCAGCGAACTCGGTGGAAACCATGGCTTCTTTGATGCCTCTTTCCCCATATCTGA
GTCCCACGGTCCTCCTGCTGGTCAGCTGTGACCTGGGTTTTGTGCGAGCAGACCGACCTCCCTCTCCTGT
GAATGTGACGGTCACTCATCTCAGAGCCAACTCAGCCACTGTGTCCTGGGACGTTCCAGAAGGCAACATC
GTCATTGGCTACTCCATTTCCCAGCAACGACAGAATGGCCCGGGGCAGCGTGTAATCAGAGAAGTGAACA
CCACCACCAGGGCCTGCGCTCTCTGGGGCCTGGCTGAAGACAGTGACTACACAGTGCAGGTTAGGAGCAT
CGGCCTCCGGGGAGAGAGCCCTCCAGGGCCCCGTGTGCACTTCCGCACGCTCAAGGGTTCTGACAGGCTG
CCCTCCAACAGCTCCAGTCCAGGTGATATTACAGTGGAGGGTCTGGATGGAGAGCGGCCATTGCAGACAG
GGGAAGTCGTCATCATTGTAGTGGTATTGCTCATGTGGGCTGCTGTAATCGGGCTATTCTGCCGTCAGTA
TGACATCATCAAGGACAACGACTCCAACAACAACCCCAAGGAGAAGGGGAAGGGGCCTGAACAGAGTCCT
CAGGGAAGGCCAGTGGGGACAACAAGACAGAAAAAGTCTCCATCAATCAACACCATTGATGTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_022424
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC139278, AAI39279
RefSeq Size 1567 bp
RefSeq ORF 696 bp
Locus ID 64339
UniProt ID Q3TR08
Cytogenetics 5 B1
Gene Summary Acts as an anti-inflammatory factor in the intestine and colon. Binds to and acts on macrophages to downregulate pro-inflammatory gene expression. Affects key macrophage functions, including phagocytosis, by downregulating many key pathways for macrophage activation, partly via by STAT3 activation and signaling. May be required to dampen the immunological response in colitis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice junction in the 3' end of the coding sequence compared to variant 1, that causes a frameshift. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.