Rabgap1l (NM_001038621) Mouse Untagged Clone

CAT#: MC209810

Rabgap1l (untagged) - Mouse RAB GTPase activating protein 1-like (Rabgap1l), transcript variant 2, (10ug)


  "NM_001038621" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rabgap1l"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rabgap1l
Synonyms 5830411O09Rik; 8430421H08Rik; 9630005B12Rik; AW049894; Hh1; HHL; mKIAA0471
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209810 representing NM_001038621
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGAAGGGGTGCCCTGCCCAGCCCCAGCTGCTAAGCTCACACCTCCTGTCAAAAAGTCCCAGGACA
TGCACGACGAGAGGAGCAAGCTGGTGAATGAGTATGCATGTCGAGTGCTGGAACTTCTGGGGATGGGGCA
TCGGCTGTTTGTGCCACGGCTTCTGGCGACCTCAAAGGAAGACCTCCTTCAGGCTGATTTTGAAGGTGCT
TTGAAGTTTTTCAGAGTTCAGCTTCCAAAGAGATACCGGGCAGAGGAGAATGCAAGAAGATTGATGGAAC
AGGCTTGCAATATTAAAGTACCAACCAAAAAGCTGAAGAAATATGAAAAAGAATATCAGGCGATGCGGGA
GAATCAGCTGCAGCAGGAGGACCCAATGGATAGATACAAGAGGGAGAACCGAAGATTACAGGAGGCCAGC
ATGAGGTTGGAACAAGAAAATGATGACCTTGCCCATGAACTAGTGACAAGCAAAATTGCTCTGCGGAATG
ACTTGGATCAGGCAGAAGACAAGGCTGATGTGCTGAATAAGGAGCTCCTCTTTACCAAGCAGAGGTTGGT
GGAGACTGAGGAAGAGAAGAGGAAGCAAGAGGAGGAGACCGCCCAGCTAAAAGAAGTCTTCAGGAAACAG
TTAGAAAAGGCAGAATATGAGATAAAGAAGACAACAGCTATCATTGCTGAGTATAAACAGATATGTTCTC
AATTAAGTACCAGGCTGGAGAAACAGCAAGCAGCCAGCAAGGAGGAGCTAGAAGCAGTAAAGGGTAAGAT
GATGGCATGCAAACACTGCAGTGATATCTTCAGCAAGGAAGGAGCTTTAAAGCCAGTGGCCGTAAATAGA
GAGGACCAGGGACTTGAAGCAGATGATGAAAAGGACTCACTTAAGAAGCAGCTGAGGGAGATGGAACTGG
AACTGGCACAGACCAAACTGCAGCTGGTGGAAGCCAAGTGCAAAATCCAGGAACTTGAGCATCAGAGAGG
AGCGCTTATGAATGAAATACAAGCTGCAAAAAACTCTTGGTTTAGTAAAACCCTGAACTCTATCAAAACA
GCCACAGGCACTCAGCCACTACAGCCGCCACAGGCTCCCCAGCCACCCAAGGAGAGCACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001038621
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001038621.2, NP_001033710.1
RefSeq Size 6338 bp
RefSeq ORF 1113 bp
Locus ID 29809
UniProt ID A6H6A9
Cytogenetics 1 H2.1
Gene Summary GTP-hydrolysis activating protein (GAP) for small GTPase RAB22A, converting active RAB22A-GTP to the inactive form RAB22A-GDP (By similarity). Plays a role in endocytosis and intracellular protein transport. Recruited by ANK2 to phosphatidylinositol 3-phosphate (PI3P)-positive early endosomes, where it inactivates RAB22A, and promotes polarized trafficking to the leading edge of the migrating cells. Part of the ANK2/RABGAP1L complex which is required for the polarized recycling of fibronectin receptor ITGA5 ITGB1 to the plasma membrane that enables continuous directional cell migration (PubMed:27718357).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.